ChIA-PET2
February 17, 2019 ยท View on GitHub
ChIA-PET2 is a versatile and flexible pipeline for analysing different variants of ChIA-PET data from raw sequencing reads to chromatin loops.
ChIA-PET2 was named not only because it is a tool for ChIA-PET data analysis, but also because it supports at least 2 different ChIA-PET protocols (bridge linker protocol or half-linkers protocol) data, 2 modes of read alignments (short or long read alignment) and 2 dimensional contact map output.
ChIA-PET2 integrates all steps required for ChIA-PET data analysis, including linkers trimming, reads mapping, duplicates removing, peaks calling and chromatin loops calling. It supports different kinds of ChIA-PET data generated from different ChIA-PET protocols. It also provides quality controls for different steps of ChIA-PET analysis. In addition, ChIA-PET2 can use phased genotype data to call allele-specific chromatin interactions. We applied ChIA-PET2 to different ChIA-PET datasets, demonstrating its significant improved performance as well as its ability to easily process ChIA-PET raw data.
Install
ChIA-PET2 could be installed in a linux-like system with OpenMP support. The ChIA-PET2 pipeline requires the following dependencies, which are usually already installed in a bioinformatics cluster.
- BWA v0.7.10+ : for reads alignment
- MACS2 v2.1.0+ : for peaks calling
- samtools v1.3+ : for sam file manipulation
- bedtools v2.24.0+ : for bed/bedpe file manipulation
- R with the ggplot2 and VGAM packages : for calling MICC and plotting Quality Control figure
To install ChIA-PET2:
tar -zxvf ChIA-PET2.tar.gz
cd ChIA-PET2
chmod +x bin/ChIA-PET2
make
ChIA-PET2 will be installed in the bin directory in user home (~/bin) by default. It's recommended to set the ~/bin directory to the PATH.
Usage
Just type in ' ChIA-PET2 -h ' for detailed usage.
$ ChIA-PET2 -h
usage : ChIA-PET2 -g genomeindex -b bedtoolsgenome -f fq1 -r fq2 -A linkerA -B linkerB -o OUTdir -n prefixname
Use option -h|--help for more information
ChIA-PET2 0.9.3 2017.11.07
----------------------------
OPTIONS
-s|--start: start from which step(1:8): 1:Trim Linkers; 2:Map Reads; 3:Build PETs; 4:Call Peaks; 5:Find Interactions
6:Plot QC; 7:Estimate statistical confidence; 8:Phase PETs(optional), default=1
-g|--genome: genome index for bwa
-b|--bedtoolsgenome: chromsomes size file for bedtools
-f|--forward: one fastq(.gz) file
-r|--reverse: the other fastq(.gz) file
-A|--linkerA: one linker sequence, default=GTTGGATAAG
-B|--linkerB: the other linker sequence, default=GTTGGAATGT
-o|--output: output folder, default=output
-n|--name: output prefix name, default=out
-m|--mode: 0,1,2; 0: A/B linkers; 1: bridge liker; 2: Enzyme site, default=0
-e|--err: Maximum mismatches allowed in linker sequence, default=0
-k|--keepempty: 0,1,2; 0:No linker-empty reads; 1:keep 1 linker-empty read; 2:keep 2 linker-empty reads. default=0
-t|--thread: threads to run, default=1
-d|--short: short reads (0 or 1), default=0 for reads >70bp. If the read length is about 20bp, set d=1
-M|--macs2 parameters, default="-q 0.05"
-Q|--mapq: mapq cutoff, default=30
-C|--cutoffPET: PET count cutoff before running MICC, default=2
-S|--slop: slop length, default=100
-E|--extend: extend length on both sides, default=500
-l|--length: min length of reads after linker trimming. default=15
-P|--phased: optional phased genotype file: 'chr1\tstart\tend\tA\tC'
[-h|--help]: help
[-v|--version]: version
Notes
-
Suppose the bridge linker is:
5'end -> ACGCGATATCTTATCTGACT TGCGCTATAGAATAGACTGA <- 5'end
We could set the first N, e.g. 15, bases of both ends (from 5' to 3') as the parameters: "-A ACGCGATATCTTATC -B AGTCAGATAAGATAT"
-
The genome size file (bedtoolsgenome) should be tab delimited and structured as follows:
For example, Human (hg19): chr1 249250621 chr2 243199373 ... chrM 16571
Output
Important result files:
- prefixname.interactions.intra.bedpe: inra-chromosomal loops (11 columns)
- prefixname.interactions.inter.bedpe: iner-chromosomal loops (11 columns)
- prefixname.interactions.MICC: significance estimation for each loops (13 columns)
- prefixname.QCplot.pdf: Quality control figure for different steps of analysis.
prefixname.interactions.MICC file has 11+2 columns. The last 2 columns ( -log10(1-PostProbability) and FDR ) are estimated by MICC based on a Bayesian mixture model. See the toy example below. This means the chromatin loop between peak_1(chr:9118-10409) with peak depth 3330 and peak_3(chr:89064-90360) with peak depth 3814 has 39 supportive pair-end tags(PETs). -log10(1-PostProbability)=4.5 and FDR=0.03 .
| chr | start | end | chr | start | end | peak1 | peak2 | depth1 | depth2 | #PET | PP | FDR |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| chr1 | 9118 | 10409 | chr1 | 89064 | 90360 | peak_1 | peak_3 | 3330 | 3814 | 39 | 4.5 | 0.03 |
Other intermediated files include:
- prefixname_1.valid.sam
- prefixname_2.valid.sam
- prefixname.bedpe
- prefixname.rmdup.bedpe
- prefixname_peaks.slopPeak
- prefixname.trim.stat
- prefixname.bedpe.stat
Toolkit
trimLinker: trim linker sequences in the pair-end fastq(.gz) files. There will be also a summary file named output.trim.stat
$ Usage: trimLinker [-option] [argument]
option: -h show help information
-t threads
-e number of mismatch allowed in linker, default=0
-k keep empty: 0, 1, 2
-l min length of trimmed reads: default=15
-o output directory
-m mode: 0 or 1, A/B linkers(0) or bridge linker(1)
-A linkerA
-B linkerB
-n output name prefix
example: trimLinker -t 4 -o outdir -m 0 -n name -k 0 -A AAAAAAAT -B TTTTACGG fq1.fq.gz fq2.fq.gz
buildBedpe: build bedpe file from two sam files. The read names should be in the same order. keepseq_flag indicates whether to keep sequences in the bedpe file (default=0, no need to keep sequences unless we want to do allele-specific analysis).
$ buldBedpe file1.sam file2.sam output MAPQ_cutoff thread keepseq_flag
removeDup: remove duplicate PETs with N threads. The bedpe file containing the paired-end tags (PETs) is in the following format.
| chr | start | end | chr | start | end | name | score | strand1 | strand2 |
|---|---|---|---|---|---|---|---|---|---|
| chr1 | 9128 | 9228 | chr1 | 89064 | 89164 | readpair1 | . | + | - |
buildTagAlign: build tag file from bedpe file for MACS2 input.
$ buildTagAlign in.bedpe out.tag.bed
bedpe2Interaction: Detect chromatin interactions from bedpe file.
$ pairToBed -a in.bedpe -b peaks.bed -type both > tmp.bedpe
$ bedpe2Interaction tmp.bedpe interaction.out.bedpe out.bedpe.stat
QCplots.R: Plot the Quality Control figure.
$ Rscript QCplots.R directory name
MICC2.R: Call MICC package to estimate the statistically significance of chromatin loops. Default CUTOFFPET=2.
$ Rscript MICC2.R interactions.intra.bedpe interactions.inter.bedpe miccOUT CUTOFFPET
Other parameters can be provided:
$ Rscript MICC2.R interactions.intra.bedpe interactions.inter.bedpe miccOUT 2 6 1e-10
bedpe2Matrix: Generate the Hi-C style matrix. The output matrix is in triplet sparse format, which is compatible with HiCPlotter.
$ bedpe2Matrix --binsize 10000 --chrsizes chrom_hg19.sizes --ifile in.rmDup.bedpe --oprefix PREFIX --progress
bedpe2Phased: Generate the allele-specific PETs. Each line of the phased genotype file phased.bed has 5 columns separated with tabs '\t': "chr start end A C", as below.
| chr | start | end | alelle1 | allele2 |
|---|---|---|---|---|
| chr1 | 19118 | 19119 | A | C |
$ grep -v "*" in.bedpe > bothmapped.bedpe
$ pairToBed -a bothmapped.bedpe -b phased.bed -type either > bedpe.flt.bed
$ bedpe2Phased bedpe.flt.bed outputprefix
Generate a coverage track: We can transform the demo.bedpe.tag.sorted file to bigwig format to get a coverage track, which could be visualized by IGV or UCSC genome browser.
$ bedtools genomecov -i demo.bedpe.tag.sorted -bg -g chrom_hg19.sizes > demo.bedpe.tag.sorted.bedgraph
$ bedGraphToBigWig demo.bedpe.tag.sorted.bedgraph chrom_hg19.sizes demo.bedpe.tag.sorted.bigwig
Citation
Please cite the following article if you use ChIA-PET2 in your research:
- Li, G., Chen, Y., Snyder, M.P. and Zhang, M.Q. (2016) ChIA-PET2: a versatile and flexible pipeline for ChIA-PET data analysis. Nucleic acids research. doi:10.1093/nar/gkw809
If you use MICC to call significant chromatin loops (step 7 in the pipeline), please cite the following:
- He C, Zhang MQ, Wang X: MICC: an R package for identifying chromatin interactions from ChIA-PET data. Bioinformatics 2015, 31:3832-3834.
Contact
Author: Guipeng Li
Email: guipeng.lee(AT)gmail.com