blast-rs

June 22, 2026 · View on GitHub

Pure-Rust implementation of NCBI BLAST (Basic Local Alignment Search Tool). Produces byte-identical output to the C reference implementation (NCBI BLAST+ 2.17.0) for blastn, with no C dependencies. Supports blastn, blastp, blastx, tblastn, tblastx, and psiblast.

Based on NCBI BLAST+ 2.17.0 source distribution (ncbi-blast-2.17.0+-src.tar.gz, also on GitHub). The C core algorithms in src/algo/blast/core/ were ported function-by-function to Rust.

** DO NOT USE. This reposity is left for historic reasons only, for anyone interested in researching agentic translation**

  • 2026-06-22: Declaring this translation attempt a no-go with my currently best translation approach (CCC+mix of agents); either the agents get too much freedom and "does their own thing", or CCC prevents the agents from making decent progress. Newer tools are under development and a different approach will be taken

This is an LLM-mediated faithful (hopefully) translation, not the original code!

Most users should probably first see if the existing original code works for them, unless they have reason otherwise. The original source may have newer features and it has had more love in terms of fixing bugs. In fact, we aim to replicate bugs if they are present, for the sake of reproducibility! (but then we might have added a few more in the process)

There are however cases when you might prefer this Rust version. We generally agree with this page but more specifically:

  • We have had many issues with ensuring that our software works using existing containers (Docker, PodMan, Singularity). One size does not fit all and it eats our resources trying to keep up with every way of delivering software
  • Common package managers do not work well. It was great when we had a few Linux distributions with stable procedures, but now there are just too many ecosystems (Homebrew, Conda). Conda has an NP-complete resolver which does not scale. Homebrew is only so-stable. And our dependencies in Python still break. These can no longer be considered professional serious options. Meanwhile, Cargo enables multiple versions of packages to be available, even within the same program(!)
  • The future is the web. We deploy software in the web browser, and until now that has meant Javascript. This is a language where even the == operator is broken. Typescript is one step up, but a game changer is the ability to compile Rust code into webassembly, enabling performance and sharing of code with the backend. Translating code to Rust enables new ways of deployment and running code in the browser has especial benefits for science - researchers do not have deep pockets to run servers, so pushing compute to the user enables deployment that otherwise would be impossible
  • Old CLI-based utilities are bad for the environment(!). A large amount of compute resources are spent creating and communicating via small files, which we can bypass by using code as libraries. Even better, we can avoid frequent reloading of databases by hoisting this stage, with up to 100x speedups in some cases. Less compute means faster compute and less electricity wasted
  • LLM-mediated translations may actually be safer to use than the original code. This article shows that running the same code on different operating systems can give somewhat different answers. This is a gap that Rust+Cargo can reduce. Typesafe interfaces also reduce coding mistakes and error handling, as opposed to typical command-line scripting

But:

  • This approach should still be considered experimental. The LLM technology is immature and has sharp corners. But there are opportunities to reap, and the genie is not going back to the bottle. This translation is as much aimed to learn how to improve the technology and get feedback on the results.
  • Translations are not endorsed by the original authors unless otherwise noted. Do not send bug reports to the original developers. Use our Github issues page instead.
  • Do not trust the benchmarks on this page. They are used to help evaluate the translation. If you want improved performance, you generally have to use this code as a library, and use the additional tricks it offers. We generally accept performance losses in order to reduce our dependency issues
  • Check the original Github pages for information about the package. This README is kept sparse on purpose. It is not meant to be the primary source of information

Installation

cargo install blast-rs

Or build from source:

git clone https://github.com/henriksson-lab/blast-rs
cd blast-rs
cargo build --release --bin blast-cli
# Binary at target/release/blast-cli

You can also run the CLI directly from a checkout without installing it:

cargo run --release --bin blast-cli -- blastn --query query.fa --subject reference.fa

For maximum performance, compile for your native CPU:

RUSTFLAGS="-C target-cpu=native" cargo build --release --bin blast-cli

CLI Usage

The installed command is blast-cli. Its first argument is the BLAST program to run, such as blastn, blastp, blastx, tblastn, tblastx, or psiblast.

Use --db for an existing BLAST database prefix. The prefix is the path without the database extension; for example, pass --db nt_subset for files such as nt_subset.nhr, nt_subset.nin, and nt_subset.nsq. Use --subject for a plain FASTA file when you do not want to build a database first.

Basic search against a BLAST database

blast-cli blastn --query query.fa --db mydb --word_size 11 --outfmt 6

Search against a FASTA file (no database needed)

blast-cli blastn --query query.fa --subject reference.fa

Write output to a file

blast-cli blastn --query query.fa --db mydb --out results.tsv --outfmt 6
blast-cli blastn --query primers.fa --db mydb --task blastn-short \
    --max_hsps 1 --max_target_seqs 10000

Common options

# Custom scoring
blast-cli blastn --query query.fa --db mydb \
    --reward 2 --penalty -3 \
    --gapopen 5 --gapextend 2 \
    --evalue 0.001

# Plus strand only, no DUST masking
blast-cli blastn --query query.fa --db mydb --strand plus --dust no

# Limit results
blast-cli blastn --query query.fa --db mydb --max_target_seqs 100

# Pairwise text output
blast-cli blastn --query query.fa --db mydb --outfmt 0

# Custom tabular columns
blast-cli blastn --query query.fa --db mydb \
    --outfmt "6 qseqid sseqid pident qseq sseq staxid ssciname"

All options

OptionDefaultDescription
--queryrequiredQuery FASTA file
--dbBLAST database path (without extension)
--subjectSubject FASTA file (alternative to --db)
--outstdoutOutput file
--outfmt6Output format. blastn supports 0=pairwise, 5=XML, 6=tabular, 7=commented tabular, 10=CSV, 17=SAM. blastp, blastx, tblastn, and tblastx also support parity-tested pairwise/XML/commented tabular subsets. Unsupported formats fail explicitly.
--evalue10.0E-value threshold
--word_size11Word size for initial seed
--reward1Match reward
--penalty-3Mismatch penalty
--gapopen5Gap opening cost
--gapextend2Gap extension cost
--strandbothQuery strand: both, plus, or minus
--dustyesDUST low-complexity filtering
--max_target_seqs500Maximum number of target sequences
--num_threads1Number of threads
--xdrop_gap30X-dropoff for gapped extension (bits)
--xdrop_gap_final100X-dropoff for final gapped extension (bits)
--perc_identity0Minimum percent identity
# blastp: protein query vs protein subject
blast-cli blastp --query protein.fa --subject database.fa

# blastx: translated nucleotide query vs protein subject
blast-cli blastx --query nucleotide.fa --subject protein.fa

# tblastn: protein query vs translated nucleotide subject
blast-cli tblastn --query protein.fa --subject nucleotide.fa

# psiblast: iterative position-specific search
blast-cli psiblast --query protein.fa --subject database.fa

Protein and translated CLI programs support tabular/CSV output (--outfmt 6 or 10). Parity-tested pairwise, XML, and commented-tabular subsets are wired for blastp, blastx, tblastn, and tblastx; unsupported formats and unverified edge cases fail explicitly instead of emitting best-effort output.

Library Usage

Add the crate to your Cargo.toml. The package name is blast-rs, while the Rust import path is blast_rs.

[dependencies]
blast-rs = "0.12"

For local development against this checkout:

[dependencies]
blast-rs = { path = "../blast-rs" }

The library API returns structured Rust values instead of formatted BLAST text. Open a database once, reuse it for many queries, and format results yourself or with blast_rs::format.

Search an existing nucleotide database

use blast_rs::{blastn, BlastDb, SearchParams};
use std::path::Path;

fn main() -> Result<(), Box<dyn std::error::Error>> {
    // Pass the BLAST database prefix, not a specific .nin/.nsq/.nhr file.
    let db = BlastDb::open(Path::new("mydb"))?;

    let params = SearchParams::blastn()
        .evalue(1e-20)
        .strand("both")
        .filter_low_complexity(false);

    let query = b"ACGTACGTACGTACGTACGTACGTACGT";
    let results = blastn(&db, query, &params);

    for hit in &results {
        for hsp in &hit.hsps {
            println!(
                "{}\t{}..{}\t{}..{}\t{:.3}\t{:.2e}",
                hit.subject_accession,
                hsp.query_start,
                hsp.query_end,
                hsp.subject_start,
                hsp.subject_end,
                hsp.percent_identity(),
                hsp.evalue
            );
        }
    }

    Ok(())
}

High-level search API

use blast_rs::{blastp, BlastDb, BlastDbBuilder, SearchParams, SequenceEntry};
use blast_rs::db::DbType;
use std::path::Path;

fn main() -> Result<(), Box<dyn std::error::Error>> {
    // Build a protein database programmatically.
    let mut builder = BlastDbBuilder::new(DbType::Protein, "my db");
    builder.add(SequenceEntry {
        title: "target protein".into(),
        accession: "P001".into(),
        sequence: b"MKFLILLFNILCLFPVLAADNHGVSMNAS".to_vec(),
        taxid: None,
    });
    builder.write(Path::new("mydb"))?;

    let db = BlastDb::open(Path::new("mydb"))?;
    let params = SearchParams::blastp()
        .evalue(10.0)
        .num_threads(1)
        .filter_low_complexity(false);

    let results = blastp(&db, b"MKFLILLFNILCLFPVLAADNHGVSMNAS", &params);
    for r in &results {
        for hsp in &r.hsps {
            println!(
                "score={} evalue={:.2e} identity={:.1}%",
                hsp.score,
                hsp.evalue,
                hsp.percent_identity()
            );
        }
    }

    Ok(())
}

Blastn builder API

use blast_rs::BlastnSearch;

let results = BlastnSearch::new()
    .query(b"ACGTACGTACGTACGTACGTACGTACGT")
    .subject(b"NNNNNACGTACGTACGTACGTACGTACGTNNNNN")
    .run();

for hit in &results {
    println!("q={}-{} s={}-{} score={} evalue={:.2e}",
        hit.query_start, hit.query_end,
        hit.subject_start, hit.subject_end,
        hit.score, hit.evalue);
}

Utility functions

use blast_rs::algo::blast::api::{reverse_complement, six_frame_translate, parse_fasta};

// Reverse complement
let rc = reverse_complement(b"ATGGCTAGCGATCG");
assert_eq!(&rc, b"CGATCGCTAGCCAT");

// Six-frame translation
let frames = six_frame_translate(b"ATGGCTAGCGATCGATCGATCGATCG");
assert_eq!(frames[0].frame, 1);
assert_eq!(frames[0].protein[0], b'M'); // ATG = Met

// FASTA parsing
let seqs = parse_fasta(b">seq1\nACGT\n>seq2\nTGCA\n");
assert_eq!(seqs.len(), 2);

Read BLAST databases

use blast_rs::db::BlastDb;
use std::path::Path;

let db = BlastDb::open(Path::new("mydb")).unwrap();
println!("{} sequences", db.num_oids);

for oid in 0..db.num_oids {
    let packed_seq = db.get_sequence(oid);
    let seq_len = db.get_seq_len(oid);
    let accession = db.get_accession(oid);
    println!("{}: {} bases", accession.unwrap_or_default(), seq_len);
}

Output formatting

use blast_rs::algo::blast::format::{format_tabular, TabularHit};
use std::io;

let hits: Vec<TabularHit> = /* ... */;
format_tabular(&mut io::stdout(), &hits).unwrap();

Module Structure

Single crate blast-rs with modules:

ModuleDescription
blast_rs::apiHigh-level search API (blastp, blastn, blastx, tblastn, tblastx, BlastnSearch builder, DB builder)
blast_rs::searchCore nucleotide search engine (seed scanning, ungapped/gapped extension)
blast_rs::protein_lookupProtein word lookup table with neighborhood word generation
blast_rs::proteinProtein ungapped extension, gapped alignment, and scoring
blast_rs::pssmPSI-BLAST PSSM computation (Henikoff weighting, pseudocounts)
blast_rs::statKarlin-Altschul statistics, KBP computation
blast_rs::tracebackGapped alignment with traceback
blast_rs::matrixScoring matrices (BLOSUM45/50/62/80/90, PAM30/70/250, nucleotide)
blast_rs::dbBLAST database reader/writer (v4/v5), taxonomy ID/name lookups (.nto, taxdb)
blast_rs::inputFASTA parser (via noodles-fasta) with BLASTNA/NCBIstdaa encoding
blast_rs::formatOutput formatting (tabular, pairwise, XML, SAM)
blast_rs::filterDUST low-complexity masking
blast_rs::utilSix-frame translation, genetic code, coordinate mapping

Benchmarks

These numbers are only meant to track this translation against the local NCBI BLAST+ 2.17.0 reference binary. They are not general performance claims. The benchmarks below are intentionally real-data oriented and include parity checks; they are better used as regression baselines than marketing numbers.

Benchmark setup:

  • Rust binary: target/release/blast-cli
  • Reference binaries: ncbi-blast-2.17.0+-src/c++/ReleaseMT/bin/*
  • Build used for this run: release build, no LTO
  • Host date: 2026-06-01
  • Threads: 1
  • Output: tabular stdout redirected to files, then sorted line-set and coordinate-set comparisons against the reference output
  • Timing/RSS: one run per case with /usr/bin/time -v

Command shape:

target/release/blast-cli <program> \
    -query <query.fa> -db <db> -num_threads 1 \
    -outfmt '6 qseqid sseqid qstart qend sstart send bitscore evalue' \
    -evalue 10 > rust.tsv

ncbi-blast-2.17.0+-src/c++/ReleaseMT/bin/<program> \
    -query <query.fa> -db <db> -num_threads 1 \
    -outfmt '6 qseqid sseqid qstart qend sstart send bitscore evalue' \
    -evalue 10 > ncbi.tsv

Real-data fixture results:

ProgramQueryDatabaseParity summaryRust time / RSSNCBI time / RSSRelative speed
blastn/tmp/bench/nt20.fatests/fixtures/large_db/celeganssorted row-set identical: 1160/1160 rows2.65 s / 87 MB0.31 s / 74 MBRust 8.5x slower
blastx/tmp/bench/nt20.fatests/fixtures/seqp/seqpcoordinate rows shared 66/73 NCBI; 6 Rust-only, 7 NCBI-only8.78 s / 9 MB0.81 s / 28 MBRust 10.8x slower
blastx -comp_based_stats 0/tmp/bench/nt20.fatests/fixtures/seqp/seqpsorted row-set identical: 113/113 rows1.20 s / 10 MB0.55 s / 28 MBRust 2.2x slower
tblastn/tmp/bench/prot30.fatests/fixtures/seqn/seqncoordinate rows shared 56/71 NCBI; 17 Rust-only, 9 NCBI-only4.22 s / 9 MB0.36 s / 26 MBRust 11.7x slower
tblastn -comp_based_stats 0/tmp/bench/prot30.fatests/fixtures/seqn/seqncoordinate rows shared 79/88 NCBI; 1 Rust-only, 6 NCBI-only1.11 s / 8 MB0.19 s / 25 MBRust 5.8x slower
tblastx/tmp/bench/nt10.fatests/fixtures/seqn/seqncoordinate rows shared 239/263 NCBI; 8 Rust-only, 5 NCBI-only1.18 s / 9 MB0.41 s / 26 MBRust 2.9x slower

The blastn case is exact on this fixture. The translated-search cases still show small residual hit-set differences on broader real data, mostly around translated hit selection and near-threshold HSPs.

AMRFinderPlus workload results:

BLAST_RS_CLI_BIN=target/release/blast-cli \
BLAST_RS_PERF_REPS=1 \
BLAST_RS_PERF_THREADS=1 \
cargo test --release --test amr_workload_perf -- --ignored --nocapture

This uses the sibling ../ncbi-amrfinderplus-rs checkout:

ProgramWorkloadParity summaryRust time / RSSNCBI time / RSSRelative speed
blastptests/golden/test_prot.fa vs AMRProt 2026-03-24.17630 shared hit pairs; 22 NCBI-only, 37 Rust-only; recall 0.9971, precision 0.99522.373 s / 477.8 MB1.731 s / 75.9 MBRust 1.37x slower
blastxtests/golden/test_dna.fa vs AMRProt 2026-03-24.112621 shared hit pairs; 158 NCBI-only, 162 Rust-only; recall 0.9876, precision 0.987312.637 s / 493.1 MB6.579 s / 87.9 MBRust 1.92x slower

The AMR workload passes the harness recall threshold. Peak RSS remains higher for blast-rs, though the dense protein word-size 5 lookup now builds directly into its finalized backbone layout instead of staging table-sized Vec<Vec<_>> rows.

Algorithms

This is a faithful port of the NCBI BLAST+ C engine algorithms:

Nucleotide (blastn)

  • Seed scanning: Step-4 packed byte scanning with 8-mer lookup table and presence vector (PV) array, matching s_BlastSmallNaScanSubject_8_4
  • Word extension: Left/right extension from 8-mer to full word size, matching s_BlastSmallNaExtend
  • Diagonal tracking: Hash-based diagonal table to prevent redundant extensions, matching BLAST_DiagTable
  • Ungapped extension: X-dropoff extension with scoring matrix, matching s_NuclUngappedExtend
  • Gapped alignment: Bidirectional X-dropoff DP with traceback, matching ALIGN_EX
  • Score-only preliminary extension: Fast DP without traceback for pre-filtering, matching Blast_SemiGappedAlign
  • Statistics: Full Karlin-Altschul parameter computation (Newton-Raphson Lambda, DP K, Horner H), per-context KBP, length adjustment
  • Scoring matrix: Full BLASTNA 16x16 matrix with ambiguity codes
  • DUST masking: Low-complexity filtering with separate masked/unmasked query handling

Protein (blastp, blastx, tblastn, tblastx)

  • BLOSUM62 scoring matrix: Full 28x28 NCBIstdaa matrix from NCBI source
  • Neighborhood word lookup table: For each query w-mer, all amino acid words scoring >= threshold are hashed into a table with PV array for fast rejection, matching BlastAaLookupIndexQuery
  • Two-phase extension: Ungapped X-dropoff extension for filtering, then gapped X-dropoff DP with affine gap penalties for high-scoring seeds
  • Gapped alignment: Bidirectional Smith-Waterman style DP with substitution matrix, gap open/extend penalties, and X-dropoff banding
  • Six-frame translation: Forward and reverse frames with correct nucleotide coordinate mapping

PSI-BLAST

  • Henikoff position-based sequence weighting: Matches _PSIComputeSequenceWeights
  • Effective observations estimation: Entropy-based calculation matching s_effectiveObservations
  • Column-specific pseudocounts: Matches s_columnSpecificPseudocounts with NCBI constants
  • PSSM score conversion: Frequency ratio blending with BLOSUM62 background, matching _PSIConvertFreqRatiosToPSSM

Compatibility

  • Reads BLAST databases created by NCBI makeblastdb (v4 and v5 format), including taxonomy (.nto taxid files, taxdb.bti/taxdb.btd name database)
  • Output matches NCBI BLAST+ 2.17.0 byte-for-byte for blastn tabular format (-outfmt 6) on the curated fixture set and on simple queries. On large/real queries, e-values, bit scores, and HSP coordinates match exactly, but gap placement can differ on a small fraction of HSPs (score-equivalent co-optimal alignments — see "Known limitations")
  • Supports scoring parameters: reward/penalty 1/-1 through 5/-4, gap costs 0/0 through 12/8
  • Protein programs (blastp/blastx/tblastn/tblastx) use BLOSUM62 with lookup-table seeding and gapped X-dropoff DP extension; CLI output includes tabular/CSV plus parity-tested pairwise, XML, and commented-tabular subsets, with unsupported formats rejected explicitly.

See docs/parity.md for the current program, output-format, database-feature, and option support matrix.

What's not ported

The NCBI BLAST+ 2.17.0 tarball includes a large subset of the NCBI C++ Toolkit (~140MB source). The following are not yet included in blast-rs:

  • IgBLAST -- immunoglobulin/T-cell receptor analysis (igblast/)
  • Remote BLAST -- network search against NCBI servers (connect/)
  • SRA/VDB integration -- searching against Sequence Read Archive data (vdb/, sra/)
  • ASN.1 object model -- the full objects/ and serial/ framework (~40MB) for Seq-entry, Bioseq, etc.
  • Object Manager -- objmgr/ for GenBank sequence retrieval and data loading
  • Database indexing -- dbindex/ for MegaBLAST indexed searches
  • Gumbel parameter estimation -- gumbel_params/ for domain-specific statistics
  • Protein k-mer search -- proteinkmer/ for fast protein pre-filtering
  • NCBI application framework -- corelib/ (logging, config, threading, diagnostics)
  • blast_formatter -- standalone tool for reformatting archived BLAST results

Search-feature gaps

  • Out-of-frame (OOF) translated search -- intentionally not exposed via the CLI, matching NCBI BLAST+ 2.17.0, where the -frame_shift_penalty argument is commented out in both blastx_args.cpp and tblastn_args.cpp (the installed blastx/tblastn accept no -ooframe/-frame_shift_penalty option). The out-of-frame gapped-alignment DP kernels and the query-/subject-side mixed-frame translation primitives are ported and unit-tested at the library/API level, but — like NCBI 2.17.0 — there is no CLI surface and no SearchParams.is_ooframe wiring. Because the reference binary rejects the flag, CLI parity fixtures cannot be captured, so end-to-end OOF search remains an API-only capability rather than a CLI feature.

Known limitations

  • blastn gap placement on co-optimal alignments -- on large/real queries, a small fraction of HSPs (≈3/46 on a 2000 bp C. elegans query) report a different gap layout than NCBI 2.17.0. Every reportable metric is identical — pident, length, mismatches, query/subject coordinates, raw score, bit score, e-value — only the gapopen count and the gap positions within the alignment differ. These are score-equivalent co-optimal alignments: blast-rs runs greedy traceback from every word-hit seed and picks a survivor, whereas NCBI gates seeds through an interval tree against already-aligned regions so exactly one canonical seed is tracebacked per HSP (blast_gapalign.c:3993/:4176). Matching NCBI's gap choice requires porting that in-loop seed gate (replacing the post-hoc traceback dedup in src/search.rs) and rebaselining the gapped parity fixtures — a dedicated effort, not yet done.
  • Throughput and RSS -- blast-rs is currently slower than NCBI BLAST+ on the real-data CLI benchmarks above. The gap is especially visible for multi-query workloads because blast-rs re-scans the database once per query, while NCBI concatenates all queries into one lookup table and scans the database once. The AMRFinderPlus workload also shows higher peak RSS in blast-rs (~478-493 MB vs ~76-88 MB for NCBI in the run above), because this implementation still keeps more lookup/search state resident. Closing this requires a concatenated-query lookup table, a single-scan engine, and memory-layout work.

Struct-field gaps relative to NCBI

These C struct fields exist in NCBI but are not yet mirrored in our Rust equivalents. They should be added when the first caller that needs them lands; track new gaps here as they're noticed.

  • QueryInfo (blast_query_info.h): still missing first_context / last_context (we use the implicit 0 and contexts.len() - 1) and pattern_info (PHI-blast pattern occurrences — only needed if/when PHI-blast pattern stats are wired through).
  • Hsp (NCBI BlastHSP in blast_hits.h): omits num (count of linked HSPs — stored on the separate LinkBlastHsp shape used by the linker) and num_positives (computed on demand by blast_hsp_get_num_identities / midline-scan helpers). The C BlastSeg is flattened into Hsp directly; the redundant length field is computed as end - offset at the call sites.
  • BlastScoreBlk (blast_stat.h): omits alphabet_start (always 0 for NCBIstdaa/blastna in practice), comments (unused), psi_matrix (PSI-BLAST PSSM not yet stored in the score blk directly), complexity_adjusted_scoring (rmblastn-specific), and ambig_size/ambig_occupy (encoded by ambiguous_res.len() in Rust).

License

MIT OR Unlicense