megSAP - Processing system INI file

July 14, 2026 ยท View on GitHub

The processing system INI file described the wet-lab processing of the sample (adapter sequences, target region, data type, etc) and defines the main parameters for the data analysis:

  • name_short - Processing system short name (must be a valid file name).
  • name_manufacturer - Processing system full name (can be any name, including characters that are invalid in file names).
  • target_file - Target region BED file path. The target region is used to determine where indel realignment and variant calling are done.
  • adapter1_p5 - Read 1 adapter sequence (Illumina standard is AGATCGGAAGAGCACACGTCTGAACTCCAGTCA).
  • adapter2_p7 - Read 2 adapter sequence (Illumina standard is AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT).
  • type - Processing system type: WGS, WES, Panel, Panel Haloplex, Panel MIPs or RNA.
  • platform - Sequencing platform: Illumina, MGI, ONT, PacBio or Roche.
  • shotgun - true for randomly-fragmented reads, false for amplicon-based reads.
  • umi_type - Unique molecular identifier type: n/a, HaloPlex HS, SureSelect HS, ThruPLEX, Safe-SeqS or MIPs.
  • build - Only GRCh38 is supported.

Notes for the RNA analysis pipeline:

  • target_file - Target region is only used for mapping quality control.
  • build - Basename of the genome build. FASTA, STAR index and GTF annotation have to be present.

Examples

Example processing system INI files are provided here:

Note: You need to adapt the paths to the target region before using these examples! For WGS you can use this generic WGS target region independent of the kit.

back to the start page