pyBoxshade
January 22, 2023 · View on GitHub
Desktop application for colouring/shading sequence alignments
Purpose
pyBoxshade is a program for creating good-looking printouts from alignments of multiple protein or DNA sequences. The program does no alignment by itself, it takes as input a file already processed by a multiple alignment program or a multiple sequence editor. The program is an updated version of BOXSHADE, which I helped write, and which is no longer available on ExPasy servers (it is, as of this writing, available at http://arete.ibb.waw.pl/PL/html/boxshade.html). I have converted BOXSHADE from Pascal to Python/Qt, and it is available for Windows, Linux or MacOS. In the program output, identical and similar residues in the multiple alignment are represented by different colors of letters or shadings (colours of background). There are many options concerning the kind of shading to be applied, whether to include a ruler line, sequence numbering, a consensus line and so on. The original program (BOXSHADE) simply reads in a sequence, processes it, then quits. pyBoxshade holds the sequence in memory until a new sequence is read in, or the user quits. Any number of different outputs can be done with the same sequence; the output can be viewed dynamically before a version is stored as a file.
Changes/upgrades
Please contact me directly or via a bug report if you have any problems with the application, or if you wish to see additional functionality - if something seems worth doing, I am happy to consider it.
Input formats
pyBoxshade supports a number of different input formats; it uses the BioPython library for reading aligment files, and can therefore read most of the formats supported by that library. Currently this includes Clustal format (.aln), FASTA format, Phylip format (interleaved or sequential), MSF, nexus and stockholm formats. The program attempts to determine the file type, so it should handle all of these transparently.
Output formats
pyBoxshade provides four types of output, those I thought would be of most use:
- PS (PostScript) files for printing directly or further conversion. I have good success opening these files and converting to PDF, tiff or other formats with Preview (on Mac), IrfanView (Windows) or GIMP (either platform).
- RTF (Rich Text Format) for export to various word-processing and graphics programs (seems to work in TextEdit (Mac OS), Microsoft Word or OpenOffice).
- PNG (Portable Network Graphics). This format can first be viewed on screen, then saved as an image file. It is a pixel-based image format (similar to TIFF or JPEG), so is not suitable for enlarging or where high resolution images are required. In the latter case it is possible to make a larger image using a large font and shrink this image down to the required size.
- ASCII output showing either the conserved residues or the varying ones (others as '-').
Shading strategy (similarity to consensus or single sequence)
The shading algorithm used by BOXSHADE (and hence by pyBoxshade) is completely configurable by the user, and is not based on any specific mutational table. Firstly, in order for there to be a consensus of any kind at a position, a threshold fraction of the sequences must agree. This threshold fraction can be any number between 0 and 1. The number of sequences that must agree for there to be a consensus is, as you might expect, this fraction times the total number of sequences in the alignment, rounded to the nearest whole number. An additional option for this kind of consensus is to apply a different colouring/shading where all sequences have the same residue (globally conserved).
If an identity-type consensus is found, and similarity shading is in operation, the program looks to see if the remaining residues at that position are similar to the consensus residue. The amino acids that are to be considered similar to the consensus residue are defined in the 'Sims' dialog. In this dialog, S | TA | means that both T and A are considered similar to S, where there is a conserved S residue in more than threshold number of sequences. However, it does NOT mean that T and A are similar to each other. This would have to be specified in the A or T box.
If there is no identity-type consensus, the program looks for a 'consensus by similarity'; this tries to take account of the situations where most of the sequences may have (for example) R or K at a position, but neither at a high enough level to pass the threshold fraction. If there is not a single residue that is conserved (greater than the threshold) at a position, the program looks for a 'group' of amino acids that fulfills the requirements. 'Groups' are defined in the 'Grps' dialog. Users can tailor these to their personal prejudices, or base them on their favourite mutational frequency table. Any amino acid not listed is assumed not to be in a group. All members of a group are considered to be mutually similar, unlike the Sims, described above. If consensus by similarity is found, all the residues in the consensus group are shaded using the 'similar' shading defined by the user. If the user does not select 'shading by similarity', only the identity-type consensus is displayed.
Note that cases where two residues, or groups of residues, fulfill the threshold requirements (as could happen with values of the threshold fraction less than or equal to 50%) are treated as having no consensus. As an alternative to a calculated consensus based on all the sequences in the alignment, the user can choose a ‘master sequence'. In this case the user specifies one of the sequences of the alignment and that sequence is taken to be the 'consensus'. Only those residues become shaded that are identical or similar to the chosen sequence. Output obtained with this option tends to be less shaded and neglects similarities between the other (non-chosen) sequences.
Consensus display
pyBoxshade offers the possibility to create an additional line holding a consensus symbol. The way this consensus line is displayed is controlled by specifying a string of exactly three symbols, in the 'chars to print consensus' box in the layout preferences dialog. As these symbols are not immediately intuitive, a brief explanation is necessary:
- the first symbol is used for positions where there is no similar/identical relationship.
- the second symbol is used for positions where a residue or group is identical, similar or a mixture of identical and similar, in greater than the threshold number of sequences of the alignment.
- the third symbol represents positions that are identical in all sequences of the alignment.
For example, a parameter string " .*" (blank/point/asterisk) means: label all positions in the alignment with totally identical residues by an asterisk (*), all positions with greater than the threshold conserved residues by a point (.) and do not mark the other positions. Besides points, asterisks and other symbols, there are three letters that act as special characters when they appear in the string: 'B' 'L' and 'U'. A 'B' can be used to mean a blank, an 'L' means that a lowercase representation of the most abundant residue at that position is to be used instead of a fixed consensus symbol while a 'U' means an uppercase character representation of that residue. A possible application would be the string BLU where conserved residues are represented by lowercase characters and identical by uppercase characters.
Sequence numbering
There is the possibility to add numbering to the output files. The numbers are printed between the sequence names and the sequence itself on the left hand side, or at the right hand side, or both, or neither. Since most of the input files either use no numbering or number the first position in the alignment always with a "1" (and that does not necessarily reflect the numbers within the original sequence), the user can specify the starting number for each sequence (the default is that all sequences start at 1). pyBoxshade starts with the value entered for the first position and continues numbering every valid symbol, skipping blanks, '-','.' and ‘~’. If the user sets a negative start number, numbering passes straight from -1 to 1: there is no zeroth position. Sequence numbering starts from the first residue. For sequences that do not start at the beginning of the alignment, or finish well before the end (i.e. are padded extensively at the left or right end of the alignment), numbering starts on the first line one which that sequence has a residue, and stops on the line that has the last residue of that sequence. At least, that is what it is supposed to do! Let me know if it doesn’t work for your alignment.
Marker line
pyBoxshade has the ability to print a marker or ruler line over the sequence alignment. This looks like this:
....:...10....:...20....:...30....:...40....:...50....:...60
AAAAACCCCCAAAAACCCCCGGGGGTTTTTGGGGGTTTTTCCCCCTTTTTGGGGGAAAAA
Numbers are right aligned with the residue in question.
Binaries
Binaries are available for MacOS (tested on 10.13, 10.14 and 11 (Big Sur), MacOSX_Sierra (tested on 10.12 and 10.13), Windows (tested on Windows10) and linux (tested on Ubuntu18); the binaries can be found in the Releases section of this project. Note that, due to the way python applications are packaged, the Windows and linux binaries take a few seconds to start. Not all functions have been tested on all platforms, but the applications startup and open windows, load alignment files and create all the output file types. Please provide feedback on any problems, especially in Windows and linux versions.