The NEAT Project v4.5

August 15, 2026 · View on GitHub

Welcome to the NEAT project, the NExt-generation sequencing Analysis Toolkit, version 4.5. See the ChangeLog for the full version history.

NEAT v4.5

NEAT 4.5 is the current release. It adds the neat compare-vcfs subcommand, removes the deprecated cleanup_splits/reuse_splits config keys, and ships a number of performance and correctness fixes accumulated across the 4.4.x line. See the ChangeLog for details.

We consider NEAT 4.x to be a stable release line and will continue to provide bug fixes and support. We will consider new features and pull requests. Please include justification for major changes. See contribute for more information. If you'd like to use some of our code in your own, please review the license first.

We've deprecated NEAT's command-line interface options for the most part, opting to simplify things with configuration files. If you require the CLI for legacy purposes, NEAT 3.4 was our last release to be fully supported via command-line interface. Please convert your CLI commands to the corresponding configuration file for future runs.

Statement of Need

Developing and validating bioinformatics pipelines depends on access to genomic data with known ground truth. As a result, many research groups rely on simulated reads, and it can be useful to vary the parameters of the sequencing process itself. NEAT addresses this need as an open-source Python package that can integrate seamlessly with existing bioinformatics workflows—its simulations account for a wide range of sequencing parameters (e.g., coverage, fragment length, sequencing error models, mutational frequencies, ploidy, etc.) and allow users to customize their sequencing data.

NEAT is a fine-grained read simulator that simulates real-looking data using models learned from specific datasets. It was originally designed to simulate short reads and is adaptable to different machines, with custom error models and the capability to handle single-base substitutions, indel errors, and other types of mutations. Unlike simulators that rely solely on fixed error profiles, NEAT can learn empirical mutation and sequencing models from real datasets and use these models to generate realistic sequencing data, providing outputs in several common file formats (e.g., FASTQ, BAM, and VCF). There are several supporting utilities for generating models used for simulation and for comparing the outputs of alignment and variant calling to the golden BAM and golden VCF produced by NEAT.

To cite this work, please use both of the following:

  1. Stephens, Z. D., Hudson, M. E., Mainzer, L. S., Taschuk, M., Weber, M. R., & Iyer, R. K. (2016). Simulating Next-Generation Sequencing Datasets from Empirical Mutation and Sequencing Models. PLOS ONE, 11(11), e0167047. https://doi.org/10.1371/journal.pone.0167047

  2. Allen, J. M., Gandhi, K. R., Alhazmy, R., Wasnik, Y., & Fliege, C. E. (2026). Enhancing next-generation sequencing simulation: Updates to NEAT. Journal of Open Source Software, 11(121), 9056. https://doi.org/10.21105/joss.09056

DOI

Table of Contents

Prerequisites

The most up-to-date requirements are found in environment.yml.

  • Some version of Anaconda to set up the environment
  • python >= 3.10
  • poetry >= 2.0
  • biopython == 1.85
  • pkginfo
  • matplotlib
  • numpy >= 2.2
  • pyyaml
  • scipy
  • pysam >= 0.23
  • frozendict

NEAT assumes a Linux environment and was tested primarily on Ubuntu Linux. It should work on most Linux systems. If you use another operating system, please install WSL or a similar tool to create a Linux environment to operate NEAT from. For setting up NEAT, you will need Anaconda (or miniconda). The method described here installs NEAT as a base package in the active conda environment, so whenever you want to run NEAT, you can first activate the environment, then run from any place on your system. If you desire VCF files, please install also bcftools. For your convenience, we have added bcftools to the environment file, as it is available from conda. You may remove this line if you do not want or need VCF files with the variants NEAT added.

Installation

To install NEAT, you must create a virtual environment using a tool such as conda.

First, clone the environment and move to the NEAT directory:

$ git clone https://github.com/ncsa/NEAT.git
$ cd NEAT

A quick form of installation uses bioconda. You must run these commands inside the NEAT project directory.

(base) $ conda create -n neat -c conda-forge -c bioconda neat
(base) $ conda activate neat
(neat) $ neat --help # tests that NEAT has installed correctly

Alternatively, instead of the bioconda method, you can use the poetry module in build a wheel file, which can then be pip installed.

Once conda is installed, the following command can be run for easy setup. In the NEAT repository, at the base level is the environment.yml file you will need. Change directories into the NEAT repository and run:

(base) $ conda env create -f environment.yml
(base) $ conda activate neat
(neat) $ poetry install
(neat) $ neat --help # tests that NEAT has installed correctly

Assuming you have installed conda, run source activate or conda activate.

NEAT is tested on Linux. macOS may work but is not regularly tested; on Windows, use WSL.

Alternatively, if you wish to work with NEAT in the development-only environment, you can use poetry install within the NEAT repo, after creating the conda environment:

$ conda env create -f environment.yml
$ conda activate neat
$ poetry install

Any updates to the NEAT code will be instantly reflected with a poetry install version.

Notes: If any packages are struggling to resolve, check the channels and try to manually pip install the package to see if that helps (but note that NEAT is not tested on the pip versions). If poetry hangs for you, try the following fix (from https://github.com/python-poetry/poetry/issues/8623):

export PYTHON_KEYRING_BACKEND=keyring.backends.null.Keyring

Then, re-run poetry install.

Test your install by running:

$ neat --help

You can also try running it using the Python command directly:

$ python -m neat --help

Usage

NEAT's core functionality is invoked using the read-simulator command. Here's the simplest invocation of read-simulator using default parameters. This command produces a single-ended FASTQ file with reads of length 151, ploidy 4, coverage 15x, default sequencing substitution, and default mutation rate models.

Contents of neat_config.yml:

reference: /path/to/my/genome.fa
read_len: 151
ploidy: 4
coverage: 15
neat read-simulator -c neat_config.yml -o simulated_data

The --output (-o) option sets the folder to place output data. If the folder does not exist, Python will attempt to create it. To specify a common filename prefix, you can additionally add the --prefix (-p), e.g., -p ecoli_20x will result in output files ecoli_20x.fastq.gz, ecoil_20x.vcf.gz, etc.

A config file is required. The config is a .yml file specifying the input parameters. The following is a brief description of the potential inputs in the config file. See NEAT/config_template/template_neat_config.yml for a template config file to copy and use for your runs. It provides a detailed description of all the parameters that NEAT uses.

To run the simulator in multithreaded mode, set the threads value in the config to something greater than 1.

reference: Full path to a FASTA file to generate reads from.

read_len: The length of the reads for the FASTQ (if using). Integer value, default 151.

coverage: Desired average coverage depth. Numeric value (fractional allowed, e.g. 0.5 for low-pass simulation), must be > 0, default = 10.

ploidy: Desired value for ploidy (# of copies of each chromosome in the organism, where if ploidy > 2, "heterozygous" mutates floor(ploidy / 2) chromosomes). Default is 2.

paired_ended: If paired-ended reads are desired, set this to True. Setting this to True requires either entering values for fragment_mean and fragment_st_dev or entering the path to a valid fragment_model.

fragment_mean: Use with paired-ended reads, setting a fragment length mean manually.

fragment_st_dev: Use with paired-ended reads, setting the standard deviation of the fragment length dataset.

The following values can be set to True or omitted to use defaults. If True, NEAT will produce the file type.

The default is given:

produce_bam: False
produce_vcf: False
produce_fastq: True

More parameters are below:

ParameterDescription
error_modelFull path to an error model or quality score model generated by NEAT. Leave empty to use default model (default model based on human, sequenced by Illumina).
mutation_modelFull path to a mutation model generated by NEAT. Leave empty to use a default model (default model based on human data sequenced by Illumina).
fragment_modelFull path to fragment length model generated by NEAT. Leave empty to use default model (default model based on human data sequenced by Illumina).
gc_modelFull path to GC-bias model generated by NEAT. Leave empty for no GC bias.
avg_seq_errorAverage sequencing error rate for the sequencing machine. Use to increase or decrease the rate of errors in the reads. Float between 0 and 0.3. Default is set by the error model.
rescale_qualitiesRescale the quality scores to reflect the avg_seq_error rate above. Set True to activate if you notice issues with the sequencing error rates in your dataset.
quality_offsetASCII offset for quality score encoding. Default 33 (Sanger/Illumina 1.8+ Phred+33). Only change this if your data uses a non-standard encoding (valid range 33–64).
include_vcfFull path to list of variants in VCF format to include in the simulation. These will be inserted as they appear in the input VCF into the final VCF, and the corresponding FASTQ and BAM files, if requested.
target_bedFull path to list of regions in BED format to target. All areas outside these regions will have coverage of 0.
discard_bedFull path to a list of regions to discard, in BED format.
mutation_rateDesired rate of mutation for the dataset. Float between 0.0 and 0.3 (default is determined by the mutation model).
mutation_bedFull path to a list of regions with a column describing the mutation rate of that region, as a float with values between 0 and 0.3. The mutation rate must be in the third column as, e.g., mut_rate=0.00.
rng_seedManually enter a seed for the random number generator. Used for repeating runs. Must be an integer.
min_mutationsSet the minimum number of mutations that NEAT should add, per contig. Default is 0. We recommend setting this to at least one for small chromosomes, so NEAT will produce at least one mutation per contig.
overwrite_outputIf true, existing output files with the same name will be overwritten. Default false (NEAT exits with an error if output files already exist).
no_coverage_biasIf true, disables statistical coverage models and forces uniform coverage across the genome. Intended for debugging. Default false.
threadsNumber of threads to use. More than 1 will use multi-threading to speed up processing. With threads > 1, NEAT splits each contig into chunks; with threads == 1, one chunk per contig is used.
parallel_block_sizePer-chunk size in bases when threads > 1. Default 0 (auto-tune from total genome length and thread count, targeting ~8 chunks per thread). Set to a positive integer to override. Ignored when threads == 1.

The command line options for NEAT are as follows:

Universal options can be applied to any subfunction. The commands should come before the function name (e.g., neat --log-level DEBUG read-simulator ...), except -h or --help, which can appear anywhere in the command.

Universal OptionsDescription
-h, --helpDisplays usage information
--no-logTurn off log file creation
--log-name LOG_NAMECustom name for log file, can be a full path (default is current working directory with a name starting with a timestamp)
--log-level VALUEVALUE must be one of [DEBUG, INFO, WARN, WARNING, ERROR] - sets level of log to display
--log-detail VALUEVALUE must be one of [LOW, MEDIUM, HIGH] - how much info to write for each log record
--silent-modeWrites logs, but suppresses stdout messages

read-simulator command line options

OptionDescription
-c VALUE, --config VALUEThe VALUE should be the name of the config file to use for this run
-o OUTPUT_DIR, --output_dir OUTPUT_DIRThe path to the directory to write the output files
-p PREFIX, --prefix StringThe prefix for file names

Functionality

Diagram describing the way that genReads simulates datasets

NEAT produces simulated sequencing datasets. It creates FASTQ files with reads sampled from a provided reference genome, using sequencing error rates and mutation rates learned from real sequencing data. The strength of NEAT lies in the ability for the user to customize many sequencing parameters, produce 'golden,' true-positive datasets. We are working on expanding the functionality even further to model more species, generate larger variants, model tumor/normal data, and more!

Features:

  • Simulate single-end and paired-end reads
  • Custom read length
  • Can introduce random mutations and/or mutations from a VCF file
    • Supported mutation types include SNPs, indels (of any length), inversions, translocations, duplications
    • Can emulate multi-ploid heterozygosity for SNPs and small indels
  • Can simulate targeted sequencing via BED input specifying regions to sample from
  • Can accurately simulate large, single-end reads with high indel error rates (PacBio-like) given a model
  • Specify simple fragment length model with mean and standard deviation or an empirically learned fragment distribution
  • Simulates quality scores using either the default model or empirically learned quality scores using neat gen_mut_model
  • Introduces GC-bias using an empirically learned model from neat model-gc-bias
  • Introduces sequencing substitution errors using either the default model or empirically learned in utilities
  • Output a VCF file with the 'golden' set of true positive variants. These can be compared to bioinformatics workflow output (includes coverage and allele balance information)
  • Output a BAM file with the 'golden' set of aligned reads. These indicate where each read originated and how it should be aligned with the reference
  • Create paired tumour/normal datasets using characteristics learned from real tumour data
  • Optionally model 3′ sequencing-adapter readthrough for short-insert libraries (cfDNA, FFPE, small RNA)

3′ Adapter Readthrough

A sequencer runs a fixed number of cycles no matter how long the insert is. When the insert is shorter than read_len, the polymerase runs off the end of the fragment and into the adapter ligated at the far end, so the read's 3′ tail is adapter sequence rather than genome. NEAT can simulate this, which makes it possible to exercise adapter-trimming QC and to simulate the short-insert library types where readthrough is expected. Disabled by default — output is unchanged when the adapters key is omitted.

adapters: true
adapter_preset: truseq        # truseq | nextera | custom
# for adapter_preset: custom, give explicit 5'->3' uppercase-ACGT sequences (quoted):
# adapter_r1: "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA"
# adapter_r2: "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"

When enabled, any fragment whose insert is shorter than read_len is kept — instead of being resampled away — and the read is padded to read_len at its 3′ end with adapter sequence: read 1 gets adapter_r1, read 2 gets adapter_r2 (appended after read 2 is reverse-complemented, so it lands where a trimmer expects it). Adapter bases carry the same quality and substitution-error models as genomic bases, are marked soft-clipped in the golden BAM, and never introduce variants.

How much readthrough you get is controlled by how much of your insert distribution falls below read_len — that is, by fragment_mean and fragment_st_dev relative to read_len. With a long-insert setting (fragment_mean well above read_len) essentially no read reaches the adapter and turning this on changes nothing.

Presets:

  • truseq — Illumina TruSeq (AGATCGGAAGAGC…), the most common.
  • nextera — Nextera / transposase Mosaic End (CTGTCTCTTATACACATCT).
  • custom — supply your own adapter_r1 / adapter_r2.

Enabling this also relaxes the usual requirement that fragment_mean be at least read_len, so short-insert libraries can be simulated at all. Inserts below 25 bp are still resampled, matching the size selection real library preps apply.

When to enable it:

  • Validating adapter-trimming pipelines — generate reads with known adapter content to confirm that fastp / cutadapt / Trim Galore settings actually detect and remove it. Without this, a trimmer reports 0% adapter whether it is configured correctly or not.
  • Short-insert libraries — cfDNA, FFPE or otherwise degraded DNA, ancient DNA, small RNA, and ATAC-seq nucleosome-free fragments, where inserts sit near or below the read length.
  • Aligner soft-clip benchmarking — untrimmed adapter tails should be soft-clipped by the aligner; use this to check that behavior end to end.

To keep short inserts as genomic reads without modeling adapters — for example to study the coverage behavior of a short-insert library on its own — set keep_short_fragments: true instead of enabling adapters. Short fragments are then emitted as insert-length reads with no padding.

Note on coverage: short inserts carry fewer genomic bases per read, and their mates overlap, so realized depth is below the requested coverage. This is a property of the library, not an error; NEAT reports the requested value and does not compensate for it.

Output ordering

The BAM file NEAT produces is coordinate-sorted (by construction at write time — no separate sort pass is run, which used to allocate ~1 GB of sort buffer at stitch time).

The FASTQ files are written in the natural fragment-sampling order. This is roughly random — fragments are drawn from batched random positions — but is not a strict uniform shuffle. If your downstream tooling assumes a real-sequencer-style shuffle, pipe the FASTQ through seqkit shuffle:

# Single-end
seqkit shuffle reads.fastq.gz -o reads.shuffled.fastq.gz

# Paired-end — use a shared seed so the two files stay mate-aligned
seqkit shuffle -s 42 reads_r1.fastq.gz -o reads_r1.shuffled.fastq.gz
seqkit shuffle -s 42 reads_r2.fastq.gz -o reads_r2.shuffled.fastq.gz

Estimated runtimes

Note: The tables below are from the original NEAT 4.4 (v4.4.0) benchmark. NEAT v4.4.4 is roughly 13× faster on multi-threaded ecoli and uses ~3× less memory thanks to the performance work in v4.4.3 and v4.4.4. The relative shape of the tables (size scaling, contig vs. size mode tradeoffs) remains accurate, but absolute runtimes should be divided by ~10–15× for v4.4.4+. See ChangeLog.md (v4.4.3 and v4.4.4 entries) for a detailed before/after table on ecoli and a c_elegans scale-test.

To give users a sense of how long neat read-simulator runs may take, we benchmarked NEAT 4.4 on several reference genomes. All runs were paired-end, with read length of 150 bp, coverage of 10, fragment mean of 300 bp, and fragment standard deviation of 50 bp. Runtimes are reported as the average across three unique runs (Avg. time (ms)) and the corresponding runtime in minutes. Cells marked with N/A indicate that NEAT was not able to run to completion.

Benchmarks were run on a System76 Meerkat with a 13th Gen Intel Core i3-1315U (8 logical cores, up to 4.50 GHz) and 16 GiB RAM, using a 512 GB SSD and Ubuntu 24.04.3 LTS (Linux kernel 6.14). Actual runtimes will vary depending on your hardware.

NEAT Single-Threaded (contig mode)

The inputs in single-threaded, contig-based mode most closely replicate the behavior of legacy versions of NEAT.

The configuration used:

  • threads: 1 (NEAT processes one contig per chunk in single-thread mode)
OrganismFile size (bytes)Avg. runtime (ms)Avg. runtime (min)
H1N113,5997020.0117
Herpes virus174,0294,9090.0818
Pneumonia2,137,44464,4241.0737
E. coli1,258,807146,8432.4474
S. cerevisiae12,310,392339,8425.6640
Honeybee228,091,137N/AN/A
Rice394,543,607N/AN/A
Miscanthus2,718,242,062N/AN/A

For small genomes, single-threaded performance is already fast (on the order of seconds). Larger genomes could not be fully benchmarked under this configuration.

NEAT Multi-Threaded (size mode)

Here we enabled NEAT’s multi-threaded mode, which splits contigs into size-based blocks and processes them concurrently. The configuration used:

  • parallel_block_size: 500000
  • produce_bam: false
  • threads: 7
OrganismFile size (bytes)Avg. runtime (ms)Avg. runtime (min)
H1N113,5991990.0033
Herpes virus174,0295,2670.0878
Pneumonia2,137,44431,1130.5186
E. coli1,258,80758,9270.9821
S. cerevisiae12,310,392139,1482.3191
Honeybee228,091,1373,040,33650.6723
Rice394,543,6074,335,12672.2521
Miscanthus2,718,242,06224,876,744414.6

For mid-sized genomes (e.g., E. coli and S. cerevisiae), enabling parallelization reduced runtimes by roughly a factor of two to three compared to the base configuration. For larger genomes (honeybee and rice), the parallel configuration may make multi-hour simulations feasible.

Access to high-performance computing systems may improve runtimes.

Examples

The following commands are examples for common types of data to be generated. The simulation uses a reference genome in fasta format to generate reads of 126 bases with default 10X coverage. Outputs paired fastq files, a BAM file and a VCF file. The random variants inserted into the sequence will be present in the VCF and the reads will show their proper alignment in the BAM. Unless specified, the simulator will also insert some "sequencing error"—random variants in some reads that represents false positive results from sequencing.

Whole genome simulation

Simulate whole genome dataset with random variants inserted according to the default model:

Contents of neat_config.yml:

reference: hg19.fa
read_len: 126
produce_bam: True
produce_vcf: True
paired_ended: True
fragment_mean: 300
fragment_st_dev: 30
neat read-simulator                 \
        -c neat_config.yml          \
        -o /home/me/simulated_reads/

Targeted region simulation

Simulate a targeted region of a genome (e.g., an exome) with a targeted bed:

Contents of neat_config.yml:

reference: hg19.fa
read_len: 126
produce_bam: True
produce_vcf: True
paired_ended: True
fragment_mean: 300
fragment_st_dev: 30
targed_bed: hg19_exome.bed
neat read-simulator                 \
        -c neat_config              \
        -o /home/me/simulated_reads/

Parallelizing simulation

Split the contig into blocks rather than reading by contig. Even in single-threaded mode this is likely to be faster. The chunk size auto-tunes from total genome length and thread count, targeting roughly 8 chunks per thread for good load balancing — on small bacterial genomes you get ~500 kb chunks (similar to NEAT's old hardcoded default), on human-scale genomes you get ~6 Mb chunks (a few hundred total instead of thousands). Specify parallel_block_size explicitly if you want to override.

Also, we demonstrate the situation where you do not want any logs produced:

neat_config.yml:

reference: giant_bacterium.fa
read_len: 150
produce_bam: True
paired_ended: True
fragment_mean: 350
fragment_st_dev: 50
threads: 12
# parallel_block_size omitted: auto-tuned from genome length and thread count.
# Set explicitly (e.g. parallel_block_size: 1000000) only if you have a reason.

Then run with the command:

neat read-simulator                 \
        --no-log                    \
        -c neat_config.yml          \
        -o /home/me/simulated_reads/

Multi-node deployment on HPC clusters

NEAT runs on a single node using Python's multiprocessing. To use multiple nodes on a supercomputer, dispatch one NEAT job per contig (or contig group) as a job-array element and concatenate the outputs afterwards. Each array task gets its own node and uses all available cores on it. NEAT itself doesn't need to know about the cluster.

SLURM example with one task per human chromosome (24 tasks):

#!/bin/bash
#SBATCH --job-name=neat-array
#SBATCH --array=1-24
#SBATCH --cpus-per-task=64
#SBATCH --mem=64G
#SBATCH --time=04:00:00

CHROM=$(awk "NR==$SLURM_ARRAY_TASK_ID" chroms.txt)   # e.g. chr1, chr2, ...
samtools faidx hg38.fa "$CHROM" > "ref_${CHROM}.fa"   # one chromosome per task

cat > "config_${CHROM}.yml" <<YAML
reference: ref_${CHROM}.fa
read_len: 150
coverage: 30
paired_ended: true
fragment_mean: 400
fragment_st_dev: 50
produce_bam: true
produce_fastq: true
produce_vcf: true
threads: ${SLURM_CPUS_PER_TASK}
YAML

neat read-simulator -c "config_${CHROM}.yml" \
                    -o "out/${CHROM}/" \
                    -p "${CHROM}"

After the array completes, concatenate the per-chromosome outputs:

# BAMs are already coordinate-sorted within each chromosome; cat in chromosome order
# produces a globally-sorted whole-genome BAM with no further      2_golden.bam ... out/chrY/chrY_golden.bam
samtools index all.bam

# FASTQs: gzip-concat preserves a valid gzip stream
cat out/*/chr*_r1.fastq.gz > all_r1.fastq.gz
cat out/*/chr*_r2.fastq.gz > all_r2.fastq.gz

# VCFs: use bcftools concat for proper merging
bcftools concat -o all.vcf.gz -Oz out/*/chr*_golden.vcf.gz
bcftools index all.vcf.gz

This gives you whole-genome simulation in roughly single-chromosome-time / nodes wall time. For a 30× human genome with 24 nodes (each 64 cores), a per-chromosome run takes ~10 min and the array finishes in ~10 min wall, plus a few minutes for the final concat.

Insert specific variants

Simulate a whole genome dataset with only the variants in the provided VCF file by setting include_vcf to the VCF path and mutation_rate: 0:

Contents of neat_config.yml:

reference: hg19.fa
read_len: 126
produce_bam: True
produce_vcf: True
paired_ended: True
fragment_mean: 300
fragment_st_dev: 30
include_vcf: NA12878.vcf
mutation_rate: 0
neat read-simulator                 \
        -c neat_config.yml          \
        -o /home/me/simulated_reads/

Single-end reads

Simulate single-end reads by omitting paired-ended options:

Contents of neat_config.yml:

reference: hg18.fa
read_len: 126
produce_bam: True
produce_vcf: True
neat read-simulator                 \
        -c neat_config.yml          \
        -o /home/me/simulated_read/ \
        -p 126_frags

Large single-end reads

Simulate PacBio-like reads by providing an error model. Note: full long-read support is planned for a separate future release and is not yet fully validated in NEAT 4.4.

Contents of neat_config.yml:

reference: hg19.fa
read_len: 5000
error_model: errorModel_pacbio.pickle.gz
avg_seq_error: 0.1
neat read-simulator                 \
        -c neat_config.yml          \
        -o /home/me/simulated_reads

Utilities

Several scripts are distributed with gen_reads that are used to generate the models used for simulation.

neat model-fraglen

Computes empirical fragment length distribution from sample paired-end data. NEAT uses the template length (tlen) attribute calculated from paired-ended alignments to generate summary statistics for fragment lengths, which can be input into NEAT.

    neat model-fraglen    \
        -i input.bam      \
        -o /path/to/prefix

and creates fraglen.pickle.gz model in working directory.

neat gen-mut-model

Takes reference genome and VCF file to generate mutation models:

neat gen-mut-model reference.fa input_variants.vcf   \
        -o /home/me/models

Trinucleotides are identified in the reference genome and the variant file. The mutation model uses trinucleotide context and selects mutation sites and alternate alleles with a transition matrix. Frequencies of each trinucleotide transition are calculated and output as a pickle file. Mutations are simulated to reflect the same context-dependent biases as the training data. As of NEAT 4.4, we have only made minor optimizations to improve the speed, and the underlying statistical models are similar to those described in the original NEAT manuscript.

OptionDescription
-o Path to output file and prefix; defaults to "neat_sim" in current working dir
--bedFlag that indicates you are using a bed-restricted VCF and FASTA (see below)
--save-trinucSave trinucleotide counts for reference
--human-sampleUse to skip unnumbered scaffolds in human references
--skip-commonDo not save common snps or high mutation areas

neat model-seq-err

Generates sequencing error model for NEAT.

The sequencing error model uses real FASTQ/BAM data, summarizing position-specific substitution, insertion, and deletion frequencies. These are stored as discrete transition matrices that are sampled during read generation to reproduce empirical error profiles. In this way, it is similar to a simple version of gen-mut-model.

This script needs revision to improve the quality-score model and to include code to learn sequencing errors from pileup data.

Note that model-seq-err does not allow for SAM inputs. If you would like to use a BAM/SAM file, please use samtools to convert to a FASTQ, then use the FASTQ as input.

Note additionally that the file must either be unzipped or bgzipped. If your file is currently gzipped, you can use samtools' built-in bgzip utility to perform this conversion.

gzip -d my_file.fastq.gz
bgzip my_file.fastq

The blocked-zip format allows for indexing of the file.

For quality scores, note that using a single number will check quality scores for every number. As this could potentially slow down model creation, binned quality scores are advisable.

Soon, we will take a samtools mpileup output as input and have some plotting features.

neat model-seq-err                                    \
        -i input_read.fq (.gz)                        \
        -o /path/to/prefix                            \
        -q quality score offset [33]                  \
        -Q maximum quality score [2, 11, 24, 37]      \
        -m maximum number of reads to process [all]   \

Please note that -i2 can be used in place of -i to produce paired data.

neat model-qual-score

Typical usage:

neat model-qual-score \
    -i input_reads.fastq(.gz)            \
    -q 33                                \
    -Q 42                                \
    -m 1000000                           \
    --markov                             \
    -o /path/to/models                   \
    -p my_qual_model

Similarly, use -i2 to produce a model for paired-ended data. -q denotes the quality score offset, while -Q is the maximum quality score.

-m denotes the maximum number of reads to process. Use a large number or input -1 to use all reads. --markov fits a quality model from the input data using a Markov chain process instead of the baseline quality score model (optional).

Finally, -o is the output directory for the model file and -p is the prefix for the output model, such that the file will be written as <prefix>.p.gz inside the output folder.

Binned quality scoring for modern Illumina instruments

Modern Illumina instruments (NovaSeq 6000, NovaSeq X, NextSeq 2000) compress Phred quality scores into a small discrete set of bins rather than emitting a continuous range. To train a model that faithfully reproduces this behaviour, use either the named --quality-preset flag or an explicit bin list via -Q.

Named presets (recommended):

# NovaSeq 6000 / NovaSeq X — Q2, Q12, Q23, Q37
neat model-qual-score -i reads.fastq.gz --quality-preset novaseq \
    -o /path/to/models -p novaseq_model

# NextSeq 2000 — Q2, Q12, Q26, Q37
neat model-qual-score -i reads.fastq.gz --quality-preset nextseq2000 \
    -o /path/to/models -p nextseq2000_model

# NextSeq 500 / MiniSeq — Q2, Q12, Q23, Q27, Q37
neat model-qual-score -i reads.fastq.gz --quality-preset nextseq500 \
    -o /path/to/models -p nextseq500_model

--quality-preset implies --markov; you do not need to pass both.

Explicit bin list — if your instrument uses non-standard bins, pass them directly with -Q:

neat model-qual-score -i reads.fastq.gz -Q 2 12 23 37 --markov \
    -o /path/to/models -p custom_binned_model

When bins are specified, both the Markov and traditional quality models will constrain simulation output to those exact Phred values.

neat model-gc-bias

Computes GC-bias model from a BAM file and reference genome. It calculates the relative weight of fragments based on their GC content.

neat model-gc-bias    \
    -i input.bam      \
    -r reference.fa   \
    -o /path/to/prefix

and creates gc_model.pickle.gz model in the working directory.

neat compare-vcfs

Compares a downstream variant caller's VCF against a NEAT-simulated truth VCF, attributing each false negative to the simulator's own configuration. The intended workflow is: run NEAT to produce a synthetic FASTQ and golden VCF → run your aligner + caller on the FASTQ → compare the caller's VCF against the golden with neat compare-vcfs.

Variant equivalence (multi-allelic normalization, haplotype-level matching) is delegated to hap.py. The NEAT-specific value-add is the false-negative attribution: each FN is tagged with one or more reasons drawn from the run config recorded in simulation_summary.json.

neat compare-vcfs golden.vcf called.vcf            \
        --neat-run-dir /path/to/neat/output/dir    \
        --output-dir /path/to/comparison/output    \
        --reference reference.fa                   \
        [--target-bed target.bed]                  \
        [--happy-bin /abs/path/to/hap.py]          \
        [--plot]                                   \
        [--chrom-aliases aliases.tsv]

Outputs (in --output-dir):

FilePurpose
comparison_summary.jsonMachine-readable: counts (TP/FN/FP), precision/recall/F1, per-reason FN counts
comparison_summary.txtHuman-readable rollup of the same
FN_with_reasons.vcfhap.py's false-negative records, each annotated with a NEAT_REASON INFO tag
happy.vcf.gz (+ siblings)Raw hap.py output preserved for inspection
fn_attribution.pngOptional — only written when --plot is set

Chromosome-name conventions: NEAT does NOT silently normalize chrom names across the reference, golden VCF, called VCF, and BED files. If your mutation_bed uses 1, 2, … but the reference uses chr1, chr2, …, compare-vcfs detects the mismatch up front and writes a warning into comparison_summary.json suggesting the rename. Pass --chrom-aliases aliases.tsv (two-column TSV: bed_name<TAB>canonical_name) to apply the rename at load time. This also handles common mitochondrial variants (M/MT/chrM/chrMT).

False-negative reason categories:

TagMeaning
outside_simulated_contigsFN's chromosome wasn't part of the NEAT run at all
outside_mutation_bedmutation_bed was set in the config and the FN falls outside its regions
outside_target_bedtarget_bed was set and the FN falls outside its regions
unknownNone of the above — NEAT has no specific explanation

simulation_summary.json prerequisite: Every neat read-simulator run now emits simulation_summary.json into its output dir as part of the standard artifacts; compare-vcfs reads this file from --neat-run-dir to drive attribution. No extra step required when running NEAT yourself; if you're working with pre-NEAT-4.5 output, re-run the simulator to produce one.

hap.py install: hap.py is an external dependency. The cleanest install path is a dedicated conda env:

conda create -n hap_py_env -c bioconda -c conda-forge hap.py -y

then point --happy-bin at /path/to/hap_py_env/bin/hap.py (or put that directory on $PATH). Without hap.py available, neat compare-vcfs exits with a clear install hint.

neat bacterial-wrapper

Runs NEAT's read simulator twice on the same reference — once with a standard mutation model ("Regular") and once with a higher mutation rate model ("Wrapped") representing a bacterium under selection pressure — then stitches the two output sets together for downstream comparison.

neat bacterial-wrapper reference.fa bacteria_name \
        -c config.yml                             \
        -o /path/to/output/dir

Outputs are written into <output_dir>/Regular/ and <output_dir>/Wrapped/ subdirectories, then stitched into the parent output directory. The config file follows the same format as neat read-simulator.

Validating NEAT Outputs

NEAT does not ship its own validation utilities. Use the standard bioinformatics tools below, which handle gzipped inputs, are actively maintained, and are typically already present in any conda/bioconda environment.

FASTQ validation

FastQC — format validation plus quality metrics (GC content, adapter contamination, per-base quality scores):

fastq read1.fastq.gz            # single-end
fastqc read1.fastq.gz read2.fastq.gz   # paired-end

fastp — lightweight format check without trimming or filtering:

fastp --in1 read1.fastq.gz --in2 read2.fastq.gz \
      --disable_adapter_trimming --disable_quality_filtering \
      --disable_length_filtering --thread 4

--disable_adapter_trimming applies to the default configuration, where reads carry no adapter. If you enabled 3′ adapter readthrough, drop that flag — the adapter content report is then a meaningful check that the reads look like real short-insert data.

BAM validation

samtools quickcheck — fast EOF and header sanity check; exits non-zero on failure, making it CI-friendly:

samtools quickcheck output.bam

samtools flagstat — alignment statistics; a non-zero exit or obviously wrong counts (e.g., 0 mapped reads when coverage > 0) indicate a problem:

samtools flagstat output.bam

Picard ValidateSamFile — comprehensive structural validation (CIGAR consistency, mate-pair pairing, flag conflicts):

picard ValidateSamFile -I output.bam -MODE SUMMARY

VCF validation

bcftools stats — reports site counts, ts/tv ratio, and indel length distribution; useful for a sanity check against expected mutation rates:

bcftools stats output_golden.vcf.gz | grep "^SN"

Tests

We provide unit tests (e.g., mutation and sequencing error models) and basic integration tests for the CLI.

Guide to run locally

conda env create -f environment.yml
conda activate neat
poetry install --with dev
pytest -q tests

Please see CONTRIBUTING.md for more information and further instructions.

Note on Sensitive Patient Data

ICGC's "Access Controlled Data" documentation can be found at <a href = https://docs.icgc.org/portal/access/ target="_blank">https://docs.icgc.org/portal/access/. To have access to controlled germline data, a DACO must be submitted. Open tier data can be obtained without a DACO, but germline alleles that do not match the reference genome are masked and replaced with the reference allele. Controlled data includes unmasked germline alleles.

rneat

We would like to introduce a sister tool, rneat, a Rust implementation of NEAT based largely on the original NEAT 2.1 codebase. It shares NEAT's core feature set while adding a native cancer-simulation workflow — tumor/normal mixtures with configurable purity, an origin-tagged truth VCF, complex structural variants (CNV/BND/INV), and per-tissue cancer models. It also keeps a low, flat memory footprint, produces byte-identical output for a given seed regardless of thread count, and ships as a single self-contained binary (no Python environment to manage). Check our repo here: <a href=https://github.com/ncsa/rusty-neat/ target="_blank">https://github.com/ncsa/rusty-neat, where you can navigate to releases to download the latest binary, or find it on <a href=https://zenodo.org/records/20577688>Zenodo. Check out rneat and let us know what you think!