RactIP for predicting RNA-RNA interaction using integer programming

June 10, 2023 · View on GitHub

Requirements

Install

For GLPK,

export PKG_CONFIG_PATH=/path/to/viennarna/lib/pkgconfig:$PKG_CONFIG_PATH
cmake -DCMAKE_BUILD_TYPE=Release -S . -B build  # configure
cmake --build build  # build
sudo cmake --install build  # install (optional)

If GLPK solver has been installed to the directory other than /usr or /usr/local, specify the option -DGLPK_ROOT_DIR=/path/to/glpk in the configure step.

For Gurobi, add -DENABLE_GUROBI to the configure step:

cmake -DENABLE_GUROBI=true -DGUROBI_DIR=/path/to/gurobi -DCMAKE_BUILD_TYPE=Release -S . -B build  # configure

For CPLEX, add -DENABLE_CPLEX to the configure step:

cmake -DENABLE_CPLEX=true -DCPLEX_ROOT_DIR=/path/to/cplex -DCMAKE_BUILD_TYPE=Release -S . -B build  # configure

For SCIP, add -DENABLE_SCIP to the configure step:

cmake -DENABLE_SCIP -DCMAKE_BUILD_TYPE=Release -S . -B build # configure

If SCIP solver has been installed to the directory other than /usr or /usr/local, specify the option -DCMAKE_MODULE_PATH=/path/to/scip/lib/cmake in the configure step.

For HiGHS, add -DENABLE_HIGHS to the configure step:

cmake -DENABLE_HIGHS -DCMAKE_BUILD_TYPE=Release -S . -B build # configure

If HiGHS solver has been installed to the directory other than /usr or /usr/local, specify the option -DHiGHS_ROOT=/path/to/highs in the configure step.

Usage

RactIP can take two FASTA formatted RNA sequences as input, then predict their joint secondary structures.

Usage: ractip [OPTIONS]... [FILES]...

-h, --help                 Print help and exit
    --full-help            Print help, including hidden options, and exit
-V, --version              Print version and exit
-a, --alpha=FLOAT          weight for hybridization  (default=`0.7')
-b, --beta=FLOAT           weight for accessibility  (default=`0.0')
-t, --fold-th=FLOAT        Threshold for base-pairing probabilities
                           (default=`0.5')
-u, --hybridize-th=FLOAT   Threshold for hybridazation probabilities
                           (default=`0.1')
-s, --acc-th=FLOAT         Threshold for accessible probabilities
                           (default=`0.003')
    --acc-max              optimize for accessibility instead of internal
                           secondary structures  (default=off)
    --acc-max-ss           additional prediction of interanal secondary
                           structures  (default=off)
    --acc-num=INT          the number of accessible regions (0=unlimited)
                           (default=`1')
    --max-w=INT            Maximum length of accessible regions
                           (default=`15')
    --min-w=INT            Minimum length of accessible regions
                           (default=`5')
    --zscore=INT           Calculate z-score via dishuffling (0=no shuffling,
                           1=1st seq only, 2=2nd seq only, or 12=both)
                           (default=`0')
    --num-shuffling=INT    The number of shuffling  (default=`1000')
    --seed=INT             Seed for random number generator  (default=`0')
-c, --use-constraint       Use structure constraints  (default=off)
    --force-constraint     Enforce structure constraints  (default=off)
    --allow-isolated       Allow isolated base-pairs  (default=off)
-e, --show-energy          calculate the free energy of the predicted joint
                           structure  (default=off)
-P, --param-file=FILENAME  Read the energy parameter file for Vienna RNA
                           package

% ractip DIS.fa DIS.fa
>DIS
CUCGGCUUGCUGAGGUGCACACAGCAAGAGGCGAG
((((.(((((((..[[[[[[.)))))))...))))
>DIS
CUCGGCUUGCUGAGGUGCACACAGCAAGAGGCGAG
((((.(((((((..]]]]]].)))))))...))))

The parentheses '( )' and the brackets '[ ]' indicate the predicted internal base-pairs and external base-pairs (interactions), respectively.

Run with Docker

docker build . -t ractip
docker run -it --rm -v $(pwd):$(pwd) -w $(pwd) ractip ractip DIS.fa DIS.fa

Run with the web server

The RactIP web server is available HERE.

References

  • Kato, Y., Sato, K., Hamada, M., Watanabe, Y., Asai, K., Akutsu, T.: RactIP: fast and accurate prediction of RNA-RNA interaction using integer programming. Bioinformatics, 26(18):i460-i466, 2010. [Link]
  • Kato, Y., Mori, T., Sato, K., Maegawa, S., Hosokawa, H., Akutsu, T.: An accessibility-incorporated method for accurate prediction of RNA–RNA interactions from sequence data, Bioinformatics, 33(2):202-209, 2017. [Link]