FASTAReader

February 24, 2012 ยท View on GitHub

description

Reads FASTA format and fetches sequences. (Node.js)

installation

$ npm install fastareader

If you haven't installed Node.js yet,

first install nvm and follow the instruction on that page.

preparation

Create FASTA Information JSON file

FASTAReader first scans through the given FASTA file.

It costs nearly one minites.

To skip this process, FASTAReader generates JSON of the scanned information.

You can save the JSON like

$ fastareader foobar.fasta > foobar.fasta.json

After generating JSON, the file is automatically read if the prefix equals to the original FASTA file and suffix equals .json.

command-line

$ fastareader <fasta file> <rname> <pos> <length> 

Then, sequence data comes to stdout.

AATGATCTATAGTCCATTAATTCAGTTACT

args

name description example
fasta file a fasta file to get sequences hg19.fa
rname a reference name to fetch. Must be in the fasta file. chr12
pos start position of the sequence to fetch (1-based coordinate). 51417222
length length of the sequence to fetch. 300

options

name description example
--compl, -c Gets complmentary strand of the sequence -c
--json, -j a FASTA Information JSON file. When the name is [fasta file].json, the file is automatically read. --json hg19.fa.json

JavaScript API Documentation

  • FASTAReader.create(fastafile, jsonfile)
  • reader.fetch(id, start, length, inverse)
  • reader.fetchByFormat(format)
  • reader.getEndPos(rname)
  • reader.hasN(rname, start, length)

FASTAReader.create(fastafile, jsonfile)

Creates an instance of FASTAReader.

  • fastafile is a fasta file to get sequence from.
  • jsonfile is optional, a FASTA Information JSON file.

Returns an instance of FASTAReader.

reader.fetch(rname, start, length, inverse)

  • rname is the reference name.
  • start is the start position of the sequence to fetch.
  • length is the length of the sequence to fetch.
  • if inverse is true, complementary strand is fetched.

Here is an example.

var reader = require('fastareader').create('/path/to/fasta.fasta');

var rname  = 'chr11';
var start  = 36181240;
var length = 420;
var rev    = true;

var seq = reader.fetch(rname, start, length, rev);

reader.fetchByFormat(format)

format is compatible with dna library

an example of the format

chr2:34100214-34101989,-

Note that this format is 0-based coordinate.

reader.getEndPos(rname)

Gets the last position of rname.

It is the same as the length of the reference.

reader.hasN(rname, start, length)

Returns true if the region contains N, otherwise returns false. The region is specified by rname, start and length. These are the same meaning as reader.fetch().

NOTICE

FASTAReader uses 1-based coordinate system.

[1-based coordinate system]

A coordinate system where the first base of a sequence is one. In this coordinate system, a region is specified by a closed interval. For example, the region between 3rd and 7th bases inclusive is [3, 7]. The SAM, GFF and Wiggle formats are using the 1-based coordinate system.

(from http://samtools.sourceforge.net/SAM1.pdf)