FastGA: A Fast Genome Aligner
June 17, 2026 ยท View on GitHub
Authors: Gene Myers & Chenxi Zhou
First: May 10, 2023
Last: December 30, 2025
-
FastGA Compare two genomes or a genome against itself and output a .1aln, .paf, or .psl file of all alignments found.
-
- GDBshow: Display select contigs or substrings thereof from a GDB
- GDBstat: Display various statistics and histograms of the scaffolds & contigs in a GDB
- ANOshow: Display annotation intervals of select contigs or subranges thereof from an ANO file
- ANOstat: Display various statistics and histograms of about the intervals in an ANO file
- GIXshow: Display range of a GIX
- ALNshow: Display selected alignments in a .1aln file in a variety of forms
- ALNplot: Display alignments in a .1aln or .paf file in a static collinear plot
-
- GDBtoFA: Converts a GDB back to the FASTA or ONEcode sequence file it was derived from
- BEDtoANO: Convert a BED formatted file to a .1ano-file
- ANOtoBED: Convert an ANO file to a BED file
- PAFtoALN: Convert a PAF formatted file with X-CIGAR strings to a .1aln file
- PAFtoPSL: Convert a PAF formatted file with X-CIGAR strings to a .psl file
- GIXrm: Remove GDBs and GIXs including their hidden parts
- GIXcp: Copy GDBs and GIXs including their hidden parts as an ensemble
- GIXmv: Move GDBs and GIXs including their hidden parts as an ensemble
- ALNchain: Alignment filtering by construction of local chains
- ALNreset: Reset a .1aln file's internal references to the GDB(s) it was computed from
Version 1.5 (December 30, 2025) ONEcode ANO Files
The addition of soft masking in V1.3 has lead to the development of a ONEcode version of a BED file, called an ANO- or .1ano-file, that records a collection of (oriented) intervals on a genome, along with a possible label and/or score for each annotation. There are new routines ANOshow, ANOstat, ANOtoBED, and BEDtoANO for showing the contents of a .1ano file, giving summary statistics about an .1ano file, and converting between BED files and .1ano files, respectively.
This change augments the interface to GIXmake, FastGA, GDBtoFA, and GDBshow, and has changed the operation of FAtoGDB. Previously, if FAtoGDB detected an "implicit" mask in the source FASTA file indicated by masked regions being lower case, and unmasked regions upper case, then this mask was recorded in the GDB. Now it is recorded in a separate .1ano file that has the same location and root name as the target GDB. Further, GIXmake has been upgraded so that you can specify multiple .1ano files on the command line, and the GIX will be masked with the union of these. Note carefully that the only way to change the mask encoded in a GIX is to rebuild the GIX. By default FastGA now does not use the soft mask (if present) in the GIX's of the genomes, but the -M flag instructs it to so so. You can also now follow each FastGA genome argument with a list of masks to apply (syntactically a primary argument beginning with #) in which case the GIX's will be rebuilt with the specified mask(s) and FastGA will soft mask accordingly. Lastly, GDBtoFA and GDBshow now take an optional #-sign mask argument that if present masks the result accordingly.
Version 1.4 (November 1, 2025) ONEaln C-Library
A C-library of routines designed to make it easy to read and access the contents of a .1aln file has been added. The interface is described here. This library of routines is in ONEaln.c with the interface declared in ONEaln.h. Caution: several of the modules used by FastGA must also be compiled in, namely, GDB.[ch], ONElib.[ch], alncode.[ch], align.[ch], and gene_core.[ch]. See the make command for ONEalnTEST in the Makefile.
Version 1.3 (July 23, 2025) Soft Masking and Log Files
Soft masking is now supported and taken advantage of by the FastGA suite. Soft masking is assumed to be specified in the input FastA files by denoting masked sequence in lower-case and unmasked sequence in upper-case. Such masks are recorded in our GDB's and in a suitable form within our GIX indices. The later required a slight modification to the GIX data structure. Old GIX's are still recognized and supported, but if you want masking you must rebuild any GDB's and GIX's that were produced previously.
Additionally,
-
GIXmake has been substantially improved to use much less memory and make better use of threads.
-
The IO performance of ALNtoPAF and ALNtoPSL has also been substantially improved.
-
A -L log file option has been added to support HPC cluster usage.
We are seeking similar improvements in FastGA proper, better handling of satellitic repeats, and higher sensitivity for distant genomes without resorting to using LastZ as a subroutine.
Overview
FastGA searches for all local DNA alignments between two high quality genomes. The core assumption is that the genomes are nearly complete involving at most several thousand contigs with a sequence quality of Q40 or better. Based on a novel adaptive seed finding algorithm and the first wave-based local aligner developed for daligner (2012), the tool can for example compare two 2Gbp bat genomes finding almost all regions over 100bp that are 70% or more similar in about 5.0 minutes wall clock time on my MacPro with 8 cores (about 28 CPU minutes). Moreover, it uses a trace point concept to record all the found alignments in a compressed and indexable ONEcode file in a very space-efficient manner, e.g. just 44.5MB for over 635,000 local alignments in our running example. These trace point encodings of the alignments can then be swiftly translated into .psl or .paf format on demand with programs provided here.
Using FastGA can be as simple as calling it with two FASTA files containing genome
assemblies where each entry is a scaffold with runs of N's separating and potentially giving the
estimated distance between the contigs thereof. By default a PAF file encoding all the
local alignments found between the two genomes is streamed to the standard output. In the
subdirectory EXAMPLE you will find a pair of sample input files, an output file, and a text file, sample_session capturing a session that serves to illustrate the use of FastGA.
Try it for yourself.
Under the surface, a number of intermediate steps take place. First, the FASTA files are converted to genome databases with extension .1gdb that are a ONEcode binary file and associated hidden file containing the ASCII DNA sequences in 2-bit compressed form. This allows FastGA to randomly access contigs and do so with four times less IO and no text parsing. Second, a genome index with extension .gidx is then built for each genome that is basically a truncated suffix array. One of the things that makes FastGA fast is that it compares these two indices against each other directly rather than looking up sequences of one genome in the index of the other. Third, FastGA records all the alignments it finds in a ONEcode binary file we refer to here as a ALN-formated file with extension .1aln that uses a very space efficient trace point encoding of each alignment. Finally in linear time, this trace point representation is converted into the desired PAF output. Note carefully, that one has the option to keep the results in the very disk efficient ALN format, and then convert it to any of PAF, PSL, or other desired alignment format on demand. The diagram immediately below summarizes and details the data flow just described.

While the entire set of blue shadowed processes can be fired off by simply calling FastGA, we provide routines to perform each step under direct control (labeled in blue along dataflow arrows). In addition we provide utilities labeled in brown that allow one to examine the intermediate GDB, GIX, and ALN files. An invocation of FastGA with the -k option or direct application of the sub-process routines, create persistent GDB and GIX entities that can be reused saving time if a given genome is to be compared repeatedly. The GDB and GIX items are actually an ensemble, consisting of a proxy file and a number of hidden files. So we provide the utilities GIXmv, GIXcp, and GIXrm to manipulate these as an ensemble. Finally, we provide the utility GDBtoFA that inverts the process of converting a FASTA file into a GDB, providing the option of removing all your fasta files, compressed or not, for the space efficient GDB representation.
FastGA features the use of the ONEcode data encoding framework with both its' GDB and ALN files that encode all the alignments found. As such FastGA also supports as input ONEcode sequence files that encode a genome, in addition to the usual Fasta format. So both FAtoGDB and GDBtoFA (despite their names) also recognize and support ONEcode SEQ files as well as FASTA.
There are three conventions for all the tools in this package designed for your convenience.
First, suffix extensions need not be given for arguments of a known set of types. For example,
if an argument is a fasta with root name "foo" without extensions, then
our commands will look for foo.fa, foo.fna, foo.fasta,
foo.fa.gz, foo.fna.gz, foo.fasta.gz if you specify
foo as the argument. Second, optional arguments (those that begin with a -) can
be in any order and in any position relative to the non-optional primary arguments (which must
be given in the order specified). We find this convenient when for example you
have typed out an entire FastGA command but forgot that you wanted PSL output instead
of the default PAF output.
All you do is append -psl to what you've already typed and then hit return. So for example,
FastGA -v Asm1 -T16 Asm2 -psl is an acceptable command line. Finally, if a -v option
is specified for a command then it always means "verbose mode", i.e. output to standard
error a running discourse of the command's progress, and if a -L option is available and
specified with a file name, then a log file of the command's performance is appended to said
file.
FastGA Reference
FastGA [-vkMS] [-L:<log:path>] [-T<int(8)>] [-P<dir($TMPDIR)>] [<format(-paf)>]
[-f<int(10)>] [-c<int(85)> [-s<int(1000)>] [-l<int(100)>] [-i<float(.7)]
<source1:path>[<precursor>] (#[<mask>[.1ano]])*
[ <source2:path>[<precursor>] (#[<mask>[.1ano]])* ]
<format> = -paf[mxsS]* | -psl | -1:<align:path>[.1aln]
<precursor> = .gix | .1gdb | <fa_extn> | <1_extn>
<fa_extn> = (.fa|.fna|.fasta)[.gz]
<1_extn> = any valid 1-code sequence file type
Performing a FastGA comparison can be as simple as issuing the command FastGA A B where A and B are FASTA, gzip'd FASTA, or ONEcode sequence files. By default 8 threads will be used but this can be changed with the -T
parameter. By default the myriad temporary files produced by FastGA are located in the directory given
by the environment varialble TMPDIR (or . if it is undefined) but this directory
can be changed with the -P option. In the default case, all the alignments found by FastGA are streamed to the standard output in PAF format. You can change this to PSL, or ONEcode ALN formatted output by specifying
the -psl and -1, options, respectively.
Note carefully, that the ONEcode -1 option produces binary output and so requires you also specify a file where the binaray will be stored.
The -paf option can further be followed by any combination of 'x', 'm', 's' or 'S', save that
'x' and 'm' do not both occur, and 's' and 'S' do not both occur. These modulators specifiy that
CIGAR strings (x or m) or CS strings (s or S) be additionally output for each alignment, e.g.
-pafxS would request a CIGAR string with X and = in aligned regions, and a long form CS string
be output.
See the argument description for ALNtoPAF below for more details.
You can also call FastGA on a single source, e.g. FastGA A, in which case FastGA compares A against
itself, carefully avoiding self matches. This is useful for detecting repetititve regions of a
genome (and their degree of repetitiveness), and for finding homologous regions between haplotypes in an unphased genome assembly, or one that is phased but not split into separate haplotype files.
FastGA uses the adaptamer seed idea of Martin Frith which means that FastGA A B does not find
the same set of alignments as FastGA B A as the adaptamers of A and B are not the same.
Specifying the 'S' option (S for symmetric) requests FastGA to use the adaptamers of both genomes
taking a bit more time but producing roughly the same result independent of the order of A and B
on the command line. The difference is typically that more repetitive alignments in B are found.
So we advise not to use the option when synteny is the goal, and only use it when understanding the
repeat structure of both genomes is of interest.
The one or two source arguments to FastGA can be either a FASTA file, a ONEcode sequence file (e.g. .1seq), a precomputed genome database (GDB), or a precomputed genome index (GIX). FastGA determines this by looking at the extension of the argument if it is given explicitly, or if only the "root" name is given then it looks first for a GIX with extenxion .gix, then a GDB with extension .1gdb, then a fasta file with one of the extensions .fa, .fna, .fasta, .fa.gz, .fna.gz, or .fasta.gz, and if all else fails then FastGA tries to open the file as a ONEcode (sequence) file. If a GIX is not present then FastGA makes one, and if in turn a GDB is not present than one is made. The objects so made are removed upon completion of the execution of FastGA unless the -k option is set in which case they are kept. Note carefully, any object already in the file system is not affected. We recommend that one replace, using FAtoGDB, every FASTA file with its GDB, as the GDB occupies less disk space and its originating FASTA can be reproduced exactly with GDBtoFA on demand. Similarly, if a group of genomes will be compared against each other, we recommend that one build a GIX for each beforehand with GIXmake. It takes about 15-30 seconds per gigabase to build a GIX, so building them prospectively saves time as FastGA need not do so every time it is called on the same genome. On the other hand, GIXs are large, occupying 14GB for every gigabase of a genome, so we recommend that one should build these as a prelude to a series of FastGA invocations and then remove them (but not their GDBs) afterwards with GIXrm.
Each source argument can be followed by a list of masks where each is a #-sign immediately followed by the
name of a .1ano file specifying a collection of intervals, e.g. FastGA A #mask1.1ano #mask2 B # will
soft mask A with the union of the intervals in mask1.1ano and mask2.1ano, and B will be
masked with the "implicit" mask B.1ano that was specified in its' FastA file using upper and lower-case
to denote unmasked versus masked sequence, respectively, or in the M-lines of its' ONEcode file, depending on the file type of its source. Specifying # masks arguments requires that the GIX for the argument in question be recomputed
even if the GIX already exists at the time of the call. If no explicit mask arguments are given then by default FastGA ignores the soft mask encoded in the GIX's, but if such mask arguments occur or the -M
flag is set, then FastGA uses the soft masks in the GIX's.
All the other options control the alignment discovery process. Generally the defaults are fine and you shouldn't bother touching these dials unless you are curious or confident. For those willing to go further FastGA uses the indices to find adaptive seed hits, where an adaptive seed at a given position p of source1, is the longest string beginning at that position that is also somewhere in source2. If the number of occurences of this string in source2 is greater than the -f option, default value 10, then the adaptamer is deemed repetitive and is not considered. Otherwise adpatamer seed hits occur at (p,q) for each q in source2 where the adaptamer at p also occurs.
FastGA then searches for runs or chains of adaptamer seed hits that (a) all lie within a diagonal band of width 128, (b) the spacing between every pair of consecutive seeds is less than -s(1000), and (c) the seeds in the chain cover at least -c(85) bases in both genomes. For these chain hits, FastGA then runs a wave-based local alignment routine that searches for a local alignment of length at least -l(100)bp with a similarity of -i(70%) or better that contains at least one of the seeds in the chain. All such found alignments are recorded as a trace-point encoding in lexicographical order of source1 contig #, and then the source2 contig #, and then the start coordinate of the alignment in source1. The options -s, -c -l, and -i can be used to modify the default thresholds for chaining and alignment just described.
Sub-Process Routines
1. FAtoGDB [-v] [-L:<log:path>] [-n<int>] <source:path>[<extn>] [<target:path>[.1gdb]]
<extn> = (.fa|.fna|.fasta)[.gz] or any valid 1-code sequence filel type
FAtoGDB takes as input a FASTA file with extension .fa, .fna, .fasta, .fa.gz, .fna.gz, or .fasta.gz, or a ONEcode sequence file (e.g. with extension .1seq) and produces a genome database or GDB with extension .1gdb. The name and location of the resulting GDB is determined as follows:
-
If only a source file is given, then the GDB is built in the same directory and with the same core name as the FASTA file.
-
If a target path is given and it is a directory, then the GDB is built in the given directory with the same core name as the FASTA file.
-
If the target path is given and it is to a file name (that may not exist) then the directory and core name of the GDB are as for this target path.
A few examples: FAtoGDB A.fa and FAtoGDB PATH/A.fna . both produce A.gdb in the current directory, FAtoGDB PATH/A.fa.gz BLUE/AG.gdb produces AG.gdb in the directory BLUE (which must
exist).
The GDB actually consists of two files. The first, visible file, is a ONEcode binary file with extension
.1gdb that contains all the information about an assembly except for the base-pair sequences which
are kept in a separate hidden file in 2-bit compressed format. If the visible file has name say,
foo.1gdb then this hidden file has name .foo.bps. We split the GDB this way as many application do not actually need the sequence, but simply need the sizes of contigs, gaps, & scaffolds and their names which are kept in the "light-weight" .1gdb portion.
Normally, n's in the FASTA file are interpreted as gaps between contigs of a scaffold. But some projects produce reconstructions that use n's as an undetermined base. Typically these occur in isolation or pairs but not in long, say 200bp, runs of n's. In this case, use the -n option to specify a threshold above which a run of n's is considered a gap, and below which the n's are considered unkown bases (and therefore treated arbitrarily as a's).
If the input is a FASTA and the convention that upper-case bases are unmasked and lower-case bases are masked, then FAtoGDB will also produce a .1ano file of this "implicit" mask that has the same root name as the resulting GDB and is in the same directory. This implicit mask can be referred to with the option/flag -#, not followed by a name, in the tools, e.g. GIXmake, that takes .1ano's as masking arguments. An implicit mask is also produced if the source is a .1seq file and it contains M-lines (mask lines).
2. GIXmake [-v] [-L:<log:path>] [-T<int(8)>] [-P<dir($TMPDIR>] [-k<int(40)>]
<source:path>[.1gdb|<extn>] (#[<mask>[.1ano]])*
or
GIXmake [-v] [-L:<log:path>] [-T<int(8)>] [-P<dir($TMPDIR>] [-k<int(40)>]
<source:path>[<extn>] <target:path>[.gix] (#[<mask>[.1ano]])*
<extn> = (.fa|.fna|.fasta)[.gz] or any valid 1-code sequence file type
Given a source FASTA, ONEcode, or GDB file, GIXmake produces a genome index or GIX of the source with extension .gix, creating the intermediate GDB if needed. The name of the .gix is determined exactly as for FAtoGDB immediately above, save that you are not allowed to create a GIX with a different core name and location than the GDB it is derived from. So note that in the summary command line syntax above you cannot specify a target if the source is a GDB, you can only do so if one is starting from a FASTA file in which both the GDB and GIX are created as per the target directive (if present).
The -T option can be used to specify the number of threads to use, where the default is 8.
The -P option similarly allows one to override the default directory given by the environmnt variable
TMPDIR (or . if it is undefined), as the directory where the
(quite large and numerous) temporary files produced by GIXmake are held during its execution.
When running on an
HPC cluster node it is very important that this directory be on the disk local to the node
running the command.
A GIX can encode a softmasking of its underlying genome, and if this is desired then one or more arguments following the source that begin with a #-sign followed immediately be the name of a .1ano file can be supplied. The masking is the union of the masks so supplied on the command line. If # alone is given then this refers to the "implicit" masking that was encoded in the case of bases in its' FASTA file or the M-lines of its' 1SEQ file, depending on the type of its source.
The genome index basically consists of a sorted table of all the k-mers (k=40 by default) and their complements that begin with a (12,8) syncmer in the underlying genome where each k-mer instance is paired with the position it came from, and the longest prefix thereof that should/could be masked. The .gix file is actually just a proxy for an ensemble of -T hidden files with the extension .ktab.<int> that contain parts of the k-mer table. Altogether these files occupy about 13-14GB per gigabase of the genome and so a GIX is quite large. Due to this structure we strongly recommend that when you want to delete, copy, or move a GIX and its GDB, that rather than doing it piecemeal by hand, you use the utilities GIXrm, GIXcp, GIXmv that will handle not only the proxy .gix file, but also the entire ensemble of hidden files as a single entity.
While you can reset the k-mer size with the -k option we strongly suggest you use the default value of 40 or at least use a bigger value which will cost you more compute time.
3. ALNtoPAF [-mxsS] [-T<int(8)>] <alignment:path>[.1aln]
ALNtoPAF converts a ALN file into a PAF file, streaming the PAF to the standard output. ALNtoPAF uses 8 threads by default, but this can be changed with the -T option.
The command must have access to the one or two GDB's from which the ALN file was derived. So the path, both relative and absolute, of these is recorded within the ALN file at the time it is created. So one should be careful not to move or rename these GDBs, the one exception being if you move them so that when you call ALNtoPAF they are at the same relative location from the current directory as was true at the time of creation. If you do have to rename or otherwise move the GDBs, then you can change the ALN file's internal references to the new GDB locations with ALNreset.
In addition to the standard PAF fields, ALNtoPAF outputs a dv:F:<fraction> SAM-tag that gives the divergences of the query from the target and a df:I:<diffs> SAM-tag that gives the number
of differences in an optimal alignment between the two intervals of the query and target.
The -m and -x options request ALNtoPAF to produce a CIGAR string tag of the form cg:Z:<cigar-string> that explicitly encodes an optimal alignment. With the -m option, aligned characters regardless of whether they are equal or not are
encoded with an 'M'. With the -x option, aligned equal characters are encoded with an '=' and
aligned unequal characters with an 'X'. Only one of 'x' or 'm can be specified.
The -s and -S options request ALNtoPAF to produce a CS string tag of the form cs:Z:<cs-string> that encodes the differences between the sequences in the short form (-s) or the entire query and reference sequences in the long form (-S). Only one of 's' or 'S can be specified.
Beware, the -m, -x, -s and -S options increase the time taken by ALNtoPAF by a factor of 10 and the file size by a factor of almost 100 ! The time taken can be ameliorated somewhat by running ALNtoPAF with more threads, controllable with the -T option.
4. ALNtoPSL [-T<int(8)>] <alignments:path>[.1aln]
ALNtoPSL converts a ALN file into a PSL file, streaming the PSL to the standard output. ALNtoPSL uses 8 threads by default, but this can be changed with the -T option.
The command must have access to the one or two GDB's from which the ALN file was derived. So the path, both relative and absolute, of these is recorded within the ALN file at the time it is created. So one should be careful not to move or rename these GDBs, the one exception being if you move them so that when you call ALNtoPAF they are at the same relative location from the current directory as was true at the time of creation. If you do have to rename or otherwise move the GDBs, then you can change the ALN file's internal references to the new GDB locations with ALNreset.
Warning, the PSL output is almost 15 times larger than the ALN file.
Viewing Utilities
1. GDBshow [-hU] [-w<int(80)>] [#[<mask>[.1ano]]] <source:path[.1gdb] [ <selection> | <FILE> ]
<selection> = <range>[+-] [ , <range>[+-] ]*
<range> = <object/position> [ - <object/position> ] | @ | .
<object/position> = @ <scaffold> [ . <contig>] [ : <position> ]
| . <contig> [ : <position> ]
| <position>
<scaffold> = # | <int> | <identifier>
<contig> = # | <int>
<position> = # | <int> [ . <int> ] [kMG]
GDBshow allows one to view a given set of scaffolds/contigs or portions thereof for the source GDB.
If the
If no other arguments besides the source GDB are given, then all the contigs of the GDB are output (in order). If a file name follows, then GDB interprets each line of the file as a <range> selection. Otherwise the argument is directly interpreted as a directive as to which scaffolds or contigs or parts thereof to display. We explain the syntax of a <selection> above in a bottom up fashion coupled with examples:
-
@s denotes the s'th scaffold in the genome, @# the last scaffold in the genome, and @id the scaffold whose fasta header is id. In this latter case the header is the part of the faster header line excluding the '>' in the first column and any white space directly following it, and excluding any tailing white space.
-
.c denotes the c'th scaffold in the genome, and .# the last contig. @s.c denotes the c'th contig of the s'th scaffold, so by extension, @s.# denotes the last contig of the s'th scaffold, @#.1 denotes the 1'st contig of the last scaffold, and so on.
-
An integer p denotes an absolute position within the genome viewing it as the concatenation of its scaffolds -- not very useful generally. But .c:p denotes the position p in the c'th contig, @s:p the position p in the s'th scaffold, .c:# the last position in the c'th contig, @s.c:p the position p in the c'th contig of the s'th scaffold, and so on.
-
A position is considered to be a location between base pairs, so the first position is 0, and in general position i is the spot between the i'th and i+1'st base pairs. In this way the number of symbols between position p and q > p is q-p. Also, the last position is the length of the sequence.
-
We support a more elaborate syntax for positions where the suffix symbols k, M, and G denote kilobases, megabases, and gigabases and a decimal fraction is permited. So for example, 10.1k is short for position 10,100, and 2.0324M is position 2,032,400.
-
A range can be a reference to a contig or scaffold in which case the entire contig or scaffold is being selected. It can also be a pair of contigs or scaffolds separated by a hyphen (-) in which case all the objects from the first to the last are being selected. For example, @3-@5 would cause GDBshow to display the 3'rd through 5'th scaffolds inclusive and .3-.5 would display the 3'rd through 5'th contigs of the genome. A range can also be a position or a pair of positions separated by a hyphen. In the first case the range is empty which is not useful for an app like GDBshow but as you'll see later it is usefule for an app like ALNshow that displays every alignment containing the position. When a pair of positions is given then all the sequence between the pairs is selected. For example, @1.3:10k-@1.5:20k selects all but the first 10kbp of the 3'rd contig of the first scaffold, all of it's 4'th contig, and the first 20k of it's 5'th contig.
-
A range can be @ in which case every scaffold is selected, and it can be . in which case every contig is selected. A genome can be considered to be a list of its' contig sequences, or a list of its' scaffold sequences each of which is its' contigs concatenated together with intervening runs of N's denoting the gap (and possibly length) between them. If a range involves an @-sign, that is, a scaffold index, then the selection is over scaffold sequences, otherwise it is over contig sequences.
-
The second component of a range when present, is assumed to have the same scaffold or contig prefix if it is not given. For example, the expression @1.3:10k-.5:20k is the same as @1.3:10k-@1.5:20k and @2:100-200 is the same as @2:100-@2:200.
-
A range can be followed by an optional sign, + or -. This indicates the selection of either the 5' or 3' direction of the selected sequence interval and affects the direction of display. For example, .3- asks GDBshow to display reverse complement of the 3'rd contig of the genome.
-
Lastly, on the command line, one can give a list of ranges separated by commas. Generally this represents the union of the range intervals, but for GDBshow indicates that it should output each range in the order given. When a file is given, then each line of the file is assumed to be a range so that the file also specifies a list of ranges.
2. GDBstat [-h[<ctg:int>,<scaf:int>]] [-hlog] <source:path[.1gdb]
GDBstat gives you summary statistics about the genome in the source GDB. It always outputs the number,
cumulative base pairs, and average size of scaffolds, contigs, and gaps. It also outputs the max, min,
and N
If the -h option is specified then GDBstat also displays histograms of contig and scaffold sizes. If the complete option is -hlog then GDBstat displays a histogram with logarithmically scaled buckets, i.e. 1, 2, 5, 10, 20, 50, 100 ... If two integers follow the -h then the first sets the histogram bucket size for the contig histogram and the second for the scaffold histogram. If nothing follows the -h then GDBstat picks a round numbered bucket size so that each histogram has about 20 buckets (defined constant NBINS in GDBstat.c if you'd like to change that).
3. ANOshow <source:path[.1ano] [ <selection> | <FILE> ]
In analogy with GDBshow documented above, ANOshow gives you a listing of the intervals and labels (if present)
in a given region or regions of the source genome for the ANO file. So the <selection> argument if present has the same interpretation as for GDBshow, save that now it is the intervals in those regions that are displayed.
4. ANOstat [-h[<itvls:int>,<covrd:int>]] [-hlog] <source:path[.1ano]
ANOstat gives you summary statistics about the anotation intervals in an ANO file in analogy with GDBstat documented above. Options are the same, save that the -h integer pair set bucket size for a histogram of interval lengths and covered segment lengths, respectively.
5. GIXshow <source:path[.gix] [ <address>[-<address>] ]
<address> = <int> | <dna:string>
GIXshow displays all or a range of k-mers in a genome index along with the positions for each k-mer. If an argument does not follow the source then the entire GIX is output starting with the smallest k-mer. Otherwise the extra argument denotes a range of k-mers either as integer positions, e.g. the i'th k-mer (in alphabetical order), or if a dna string is given it specifies the first k-mer whose prefix matches the string (or the last if it is the second argument of a range).
6. ALNshow [-arU] [-i<int(4).] [-w<int(100)>] [-b<int(10)>>
<alignments:path>[.1aln] [ <selection>|<FILE> [<selection>|<FILE>] ]
<selection> = <range>[+-] [ , <range>[+-] ]*
<range> = <object/position> [ - <object/position> ] | @ | .
<object/position> = @ <scaffold> [ . <contig>] [ : <position> ]
| . <contig> [ : <position> ]
| <position>
<scaffold> = # | <int> | <identifier>
<contig> = # | <int>
<position> = # | <int> [ . <int> ] [kMG]
ALNshow produces a printed listing of a subset of the local alignments contained in the specified ALN file, where one can optionally view the alignments in a BLAST like format. If just the ALN file is given as an argument then every alignment is displayed. If a single selection is given in addition, then only those alignments whose interval in the 1st genome intersects the selection are displayed. If a pair of selections are given then those alignments where its interval in the 1st genome intersects the 1st selection and its interval in the 2nd genome intersects the 2nd selection are displayed. If a range in the first selection is signed than that determines if the alignment is displayed with the substring of the 1st genome in the normal orientation (+, also no sign) or the complement orientation (-). If a range in the second selection, if present, is signed than only alignments in which the relative orientation of the first and second substrings agrees with the sign polarity of the selection pair are displayed. See the documentation for GDBshow for a detailed explanation of the format and meaning of selections.
The command must have access to the one or two source files from which the ALN file was derived. This can be either a Fasta file, a ONEcode SEQ file, or a GDB depending on how the ALN file was created. For example, if FastGA is run on two FASTA files without the -k option then the recorded sources will be the FASTA files. But with the -k option, then the GDB's (that are kept) are recorded. The path, both relative and absolute, of these sources is recorded within the ALN file at the time it is created. So one should be careful not to move, rename, or remove the sources, the one exception being if you move them so that when you call ALNshow they are at the same relative location from the current directory as was true at the time of creation. If you do have to rename or otherwise move the source files, then you can change the ALN file's internal references to their new locations with ALNreset.
If the -a or -r option is set then an alignment of the local alignment is displayed. The -a option puts exactly -w columns per segment of the display, whereas the -r option puts exactly -w a-read symbols in each segment of the display. The -r display mode is useful when one wants to visually compare two alignments involving the same a-read. If both the -a, and -r flags are set, then the -a alignment comes first followed by the -r alignment. If the -n option is set while either of -a or -r is set, then the scaffold names are used instead of scaffold numbers in the disply. The -i option sets the indent for the alignment displays, if they are requested. The -b option sets the number of symbols on either side of the aligned segments in an alignment display, and -U specifies that uppercase should be used for DNA sequence instead of the default lowercase.
When examining ALNshow output it is important to keep in mind that the coordinates describing an interval of a read are referring conceptually to positions between bases starting at 0 for the position to the left of the first base. That is, a coordinate c refers to the position between the c'th and c+1'st base, and the interval [b,e] captures the e-b bases from the b+1'st to the e'th, inclusive. We give an example with part of an alignment for which we will explain several additional features:
2.1 6.05c <0..3,110] x [162,039..158,933] ~ 6.18% (181,250,738 x 162,401,845 bps, 192 diffs, 32 trace pts)
0 ..........ctaaccctaaccctaaccctaaccctaaccctaaccctaa
|||||||||||||||||||||||||||||||||**|||||
162049 aaccctaaccctaaccctaaccctaaccctaaccctaacccta--cctaa 5.0%
40 ccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaacc
||||||||||||||||||||||||||||||||||||||||||||||||||
162001 ccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaacc 0.0%
90 ctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccct
|||||||||||||||*||||||||||||||||||||||||||||||||||
161951 ctaaccctaacccta-ccctaaccctaaccctaaccctaaccctaaccct 2.0%
140 aaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaa
||||||||||||||||||||||*|||||||||||||||||||||||||||
161902 aaccctaaccctaaccctaacc-taaccctaaccctaaccctaaccctaa 2.0%
. . . .
The display of a local alignment always begins with a line giving the A-scaffold & contig, then the B-scaffold & contig, then an indication of orientation (i.e. 'n' for same strand, and 'c' for the opposite strand) followed by the A-interval and B-interval that are aligned in scaffold string coordinates and then the % identify. Then in parentheses follows the lengths of the two scaffolds, the number of differences in the alignment, and the number of tracepoints used to encode the alignment between them. In particular, note carefully that when the B-item is in the complement orientation (c), then the B-interval gives the higher coordinate first, the idea being that one will align from the highest base down to the lowest base in the descending direction on B, complementing the characters as you go. Further note that in the alignment display the coordinates at the start of each line follow this orientation convention and give the coordinate of the "tick mark" just left of the first character in each line. It is useful to know if an interval reaches the beginning or end of a read, and to signal this we use angle-brackets <> instead of square brackets [].
7. ALNplot [-vSL] [-T<int(4)>] [-p[:<output:path>[.pdf]]]
[-a<int(100)>] [-e<float(0.7)>] [-n<int(100000)>]
[-H<int(600)>] [-W<int>] [-f<int>] [-t<float>]
<alignment:path>[.1aln|.paf[.gz]]> [<selection>|<FILE> [<selection>|<FILE>]]
<selection> = <range>[+-] [ , <range>[+-] ]*
<range> = <object/position> [ - <object/position> ] | @ | .
<object/position> = @ <scaffold> [ . <contig>] [ : <position> ]
| . <contig> [ : <position> ]
| <position>
<scaffold> = # | <int> | <identifier>
<contig> = # | <int>
<position> = # | <int> [ . <int> ] [kMG]
ALNplot produces a static collinear plot of the local alignments contained in the specified ALN file or PAF file in a EPS or PDF format file. If just the ALN/PAF is given as an argument then every alignment is considered for plotting. If a single selection is given in addition, then only those alignments whose interval in the 1st genome intersects the selection are considered. If a pair of selections are given then those alignments where its interval in the 1st genome intersects the 1st selection and its interval in the 2nd genome intersects the 2nd selection are considered. A selection can be comma-delimited to include multiple, interspersed ranges. These ranges will be placed in order along the axis for plotting. The selection can also be a FILE, with each line representing a range. This is equivalent to concatenating all lines and separating them with commas. See the documentation for GDBshow for a detailed explanation of the format and meaning of selections.
When the alignment input is an ALN file, the command must have access to the one or two source files from which the ALN file was derived. See ALNshow for a detailed explanation. When the alignment input is a PAF file, each sequence will be treated as a single contig, even if there are gaps. Consequently, selecting specific contigs is not possible in this case.
The default output is an EPS file sent to standard output. With the -p option, the output will be a PDF file, requiring a software ('[e]ps[to|2]pdf') to convert the EPS to PDF. You can specify the output PDF file name with the -p option; otherwise, the output file name will be determined by the input file name.
You can use the -l and -i options to filter alignment records based on alignment length and identity. By default, only the longest 100,000 alignment records are used for plotting to maintain a manageable file size. This limit can be adjusted with the -n option, and setting it to 0 will include all alignments.
The program automatically adjusts the display of the output figure based on the input data. If these automatic settings are not suitable, you can use the options -S, -L, -H, -W, -f, and -t to manually configure the display parameters.
Additional Utilities
1. GDBtoFA [-vU] [-w<int(80)> [#[<mask>[.1ano]]]
<source:path>[.1gdb] [ @ | <target:path>[<fa_extn>|.1seq] ]
<fa_extn> = (.fa|.fna|.fasta)[.gz]
GDBtoFA can produce exactly the FASTA file contents from which the source GDB was derived by a call to FAtoGDB, or if so directed a ONEcode .1seq file, i.e. it is an inverse operation for FAtoGDB. When a GDB is built it records internally where the source FASTA or ONEcode sequence file is, it's name, and it's extension. We call this the "origin" in what follows. Where the FASTA file is placed by GDBtoFA and what it is named is as follows:
-
If there is no target, then the output is streamed to the standard output (uncompressed).
-
If the target is the special symbol @, then the FASTA file is built at it's origin directory and given it's origin name and extension (implying compression if it ends with .gz).
-
If the target is a directory, then the FASTA file is built at said directory, it's name and extension are as for the origin.
-
If the target is a file (that may not exist), then the FASTA file is built at the directory and named as given by the target. If the target has an extension then that extension is used, otherwise the extension of the origin is used.
The -U, -w, and # arguments have the same interpretation as for GDBshow.
2. BEDtoANO [-T<int(8)>] <bed:path>[.bed] <genome:path>[.1gdb|<fa_extn>|<1_extn>]
<fa_extn> = (.fa|.fna|.fasta)[.gz]
<1_extn> = any valid 1-code sequence file type
-T: Number of threads to use.
Convert a BED file into a ONEcode ANO file. An ANO file can capture all the information in a BED file save for the fields denoting display information such a thickness and color and exon clustering. You must supply the genome to which the BED information applies.
3. ANOtoBED [-v] <source:path>[.1ano] [ <target:path>[.bed] ]
Convert a ONEcode ANO file into a BED file. If no target is supplied then the output is streamed to standard output.
4. PAFtoALN [-T<int(8)>] <alignments:path>[.paf]
<source1:path>[.gdb|<fa_extn>|<1_extn>] [<source2:path>[.gdb|<fa_extn>|<1_extn>]]
<fa_extn> = (.fa|.fna|.fasta)[.gz]
<1_extn> = any valid 1-code sequence file type
PAFtoALN takes a PAF file as its first argument and the two sources that were compared to produce the alignment in the PAF file as the second and third arguments. The PAF file must have CIGAR strings that use X and = to describe the alignment of ungapped segments as opposed to just M. The number of threads used is 8 by default, but can be set with the -T option. A .1aln file with the name <alignments>.1aln is produced. (NB: CIGAR strings with M could be accepted but would require the explicit reconstruction of each alignment, a possible to do if requested/required.)
5. PAFtoPSL [-T<int(8)>] [-C<str(cg:Z:)>] <alignments:path>[.paf]
PAFtoPSL takes an uncompressed PAF file as input. The input file must include CIGAR strings. Supported CIGAR operators include 'M', '=', 'X', 'I', and 'D'. By default, the CIGAR string tag is 'cg:Z:', but you can specify a different tag using the '-C' option. The custom tag must be a five-character string where the third and fifth characters are ':'. The number of threads used is 8 by default, but can be set with the -T option. Output is streamed directly to STDOUT.
6.a GIXrm [-vifg] <source:path>[.gix|.1gdb] ...
6.b GIXmv [-vinf] <source:path>[.gix|.1gdb] <target:path>[.gix|.1gdb]
6.c GIXcp [-vinf] <source:path>[.gix|.1gdb] <target:path>[.gix|.1gdb]
A GDB consists of not only a "skeleton" file with a .1gdb extension but also a hidden file with extension .bps. Likewise a GIX consists of not only a proxy file with a .gix extension but 2T hidden files with extensions of the form .ktab.<int> and .post.<int> where T is the number of threads used to create the index. As such it is cumbersome to remove, move, or copy a GDB or GIX directly with the UNIX OS as it requires you to utter 2T+3 commands or possibly only one if wild cards are used, albeit this has the potential for surprising matches affecting unexpected files. So we provide the commands GIXrm, GIXmv, and GIXcp to remove, move, or copy GDBs and/or GIXs as a single entity.
The routines operate exactly as for rm, mv, and cp including the meaning/effect of the flags -v, -i, -n, and -f. For the GIXmv and GIXcp commands both the GIX and GDB are moved or copied, where just the GDB will be affected if there is no associated GIX. On the otherhand, for GIXrm only the GIX will be deleted unless the -g flag is explicitly set in which case the GDB will also be removed. We chose this requirement as a safeguard because if you have replaced your FASTAs with the GDBs as we recommend, then deleting the GDB is tantamount to deleting your genome source!
7. ALNchain [-v] [-g<int(10000)>] [-l<int(10000)>] [-p<float(0.1)>] [-q<float(0.1)>]
[-z<int(1000)>] [-s<int(10000)>] [-n<int(1)>] [-c<float(0.5)>] [-e<0.0>]
[-f<int(1000)>] [-o<output:path>[.1aln]] <alignments:path>[.1aln]
For each pair of sequences, ALNchain generates a subset of alignments to achieve a one-to-one global alignment allowing rearrangements by selecting the best-scored local chains, adhering to user-specified constraints. We use a linear gap penalty for chaining, where the cost of a gap or overlap between consecutive alignments in the chain is defined by -p or -q. The maximum sizes of gaps and overlaps allowed in the chain can be adjusted using the -g and -l options. Chains are scored as C-G*p-O*q, where C represents the total number of unique sequence positions covered by the alignments. A chain is terminated if its score drops by more than -z.
Chains are selected based on their scores, from highest to lowest. The -s and -n options specify the minimum requirements for a chain to be considered. We track the sequence positions covered by all selected chains. For any new chain, the number of additional positions it covers on the sequences is calculated. If this number is below certain thresholds, determined by -c as a fraction of the chain size and -e as a fraction of the sequence size, the chain is not selected. When calculating the sequence positions covered by chains, the -f option is used as the upper limit for closing gaps.
8. ALNreset [-T<int(8)>] <alignments:path>[.1aln]
<source1:path>[.1gdb|<fa_extn>|<1_extn>] [<source2:path>[.1gdb|<fa_extn>|<1_extn>]]
<fa_extn> = (.fa|.fna|.fasta)[.gz]
<1_extn> = any valid 1-code sequence file type
In the unfortunate event that the internal references of a 1-code alignment file (.1aln) to its genome source files have become "stale", ALNreset allows you to reset these paths within the given file. Note carefully, that the references can be not only to a GDB but also the source 1-code or FASTA files from which a GDB can be built.
C-Library for Accessing .1aln Files
This package is intended to give one a simple interface to read and manipulate the information in a .1aln file of alignment records produced by FastGA or FasTAN. A simple use pattern for reading all the alignment records in a file is as follows:
AlnReader *reader = alnOpenReader(filename,1,true);
if (reader == NULL)
printf("Error: %s\n",alnError());
while (!alnEOF(reader))
{ AlnRecord *align = alnAlignment(reader,true);
if (align == NULL)
printf("Error: %s\n",alnError());
// do stuff with current alignment record align, e.g.
alnShowAlignment(align,stdout,8,100,10,5,false,false);
alnNext(reader);
}
alnCloseReader(reader);
This library of routines is in ONEaln.c with the interface declared in ONEaln.h. Several of the modules used by FastGA must also be compiled in, namely, GDB.[ch], ONElib.[ch], alncode.[ch], align.[ch], and gene_core.[ch]. See the make command for ONEalnTEST in the Makefile for an example.
ERROR HANDLING:
Two macro variables CHECK_ARGS and HALT_ON_ERROR found at the top of the ONEaln.c file determine which errors are detected and how they are handled according to whether the variable is defined or undefined. In the copy you downloaded they are both defined, change them before compilation to get the desired behavior.
When CHECK_ARGS is defined, all arguments are checked, e.g. the range of an index, or the state of a reader. This creates overhead for simple routines like GetContigLen so if your application is well debugged and ready for release, we suggest you undef the variable, so that only errors not under you control, e.g. when opening or reading a file, are caught. In the error listing at the end of this document, those routines whose return value must be checked regardless of the setting of CHECK_ARGS are noted.
When HALT_ON_ERROR is undefined, the detection of an error results in an error message being placed in a special buffer you can access with alnError(), and the routine in question returns with a documented error value. But if your program is not interactive, you can, for convenience, define HALT_ON_ERROR in which case the detection of an error results in the error message being written to stderr and your program halting with exit value 1. In this case you do not need to check any of the return values of the routines in the package.
When routines return with an error value, you can access an error message by calling alnError. The returned pointer is to a globally shared message string, so its contents are determined by the last routine to detect an error and write into it. A list of all the error messages emited by this library are found at the end of this document.
char *alnError()
.1ALN FILE READER:
typedef void *AlnReader // A multi-thread .1aln reader
Open the .1aln file 'name' for reading with nthreads threads. NULL is returned if there is an error, otherwise the return pointer points to the first element in an array of nthreads AlnReader's. This first element is called the master. If you want to have CIGAR strings or print alignments or otherwise need access to the sequence of the source genomes, you must set see_seq to true. Otherwise set it to false for better memory efficiency.
AlnReader *alnOpenReader(char *name, int nthreads, bool see_seq)
Each reader conceptually has a "cursor" pointing at an alignment record that can be advanced one record at a time with alnNext or jumped to the idx'th record in the file with alnGoto. To be crystal clear, alnGoto(..,1) takes you to the first alignment record, i.e. indexing begins at 1. alnNext returns true if and only if the reader has been advanced to the end of the file. AlnGoto returns true if and only if it was successful, otherwise an error has occurred.
bool alnNext(AlnReader *reader)
bool alnGoto(AlnReader *reader, int idx)
Return true iff at the end of file
bool alnEOF(AlnReader *reader)
Close all readers associated with the supplied master reader.
void alnCloseReader(AlnReader *reader)
Return (a) the total number of alignments in the file, (b) the maximum number of trace intervals in any alignment record, (c) the total number of trace intervals in the file, and (d) the trace point spacing, respectively.
int alnCount (AlnReader *reader)
int alnTraceMax (AlnReader *reader)
int alnTraceCount (AlnReader *reader)
int alnTraceSpacing(AlnReader *reader)
GENOME DATA BASE (GDB):
typedef void AlnGDB // A genome database
From the .1aln reader get the first and second genome data bases over which the alignments were found. The two pointers are equal if there was only one genome, i.e. a self-comparison. A genome data base gives one the structure of the genome as a collection of scaffolded contigs separated by gaps, as well as access to the contig's sequence if 'see_seq' was true in the call that created the reader.
AlnGDB *alnGDB1(AlnReader *reader)
AlnGDB *alnGDB2(AlnReader *reader);
The Count... routines return the # of (a) scaffolds, (b) contigs, and (c) gaps in a GDB. The Max... routines return the maximum # of contigs/gaps in any scaffold of a GDB.
int gdbScaffoldCount(AlnGDB *g)
int gdbContigCount (AlnGDB *g)
int gdbGapCount (AlnGDB *g)
int gdbContigMax (AlnGDB *g)
int gdbGapMax (AlnGDB *g)
Scaffolds are numbered starting at 1, and the first contig of a scaffold is indexed by 1. In rare, somewhat abnormal cases there can be a run of N's at the start or end of a scaffold, the length of these are obtained by gdbGapLen(g,s,0) and gdbGapLen(g,s,gdbScaffoldContigs(g,s)). The routines return -1 if an error occurs.
int gdbScaffoldLen (AlnGDB *g, int s) // Length of the s'th scaffold
int gdbScaffoldContigs(AlnGDB *g, int s) // Number of contigs in the s'th scaffold
int gdbGapLen (AlnGDB *g, int s, int p) // Length of the p'th gap of the s'th scaffold
int gdbContigLen (AlnGDB *g, int s, int c) // Length of the c'th contig of the s'th scaffold
int gdbContigStart (AlnGDB *g, int s, int c) // Start position of the c'th contig of the
// s'th scaffold (see getScaffoldSeq)
Get the scaffold name of the s'th scaffold. The string returned is in a buffer internal to the GDB and is overwritten each time this routine is called. You should copy it to memory you control if you wish it to persist beyond the last call. NULL is returned if an error occurs.
char *gdbScaffoldName(AlnGDB *g, int s)
Get the sequence spanning interval [beg,end] of the s'th scaffold of g. If buffer = NULL then the routine allocates an array of (end-beg)+1 bytes, places the requested sequence '\0'-terminated there, and returns a pointer to it. In this case the user must subsequently free this string. Otherwise, if the user supplies a non-NULL buffer pointer, then it must be of length not less than (end-beg)+1, the requested sequence is placed there '\0'-terminated, and the buffer pointer is returned. NULL is returned on an error which includes not asking for sequence access when opening the reader and requesting an interval not wholly within a contig.
Sequences positions are between base pairs, e.g. position 0 is before the first bp and position 1 is between the first and second bp. In this way the subsequence between an interval [a,b] is of length b-a and consists of the a+1'st through b'th bp of the selected sequence.
char *gdbScaffoldSeq(AlnGDB *g, int s, int beg, int end, char *buffer)
ALIGNMENT RECORDS:
typedef struct
{ int seq1, seq2; // seq1[bpos1..epos1] aligns to seq2[bpos2..epos2]
int bpos1, epos1; // with diffs differences (indels & substitutions).
int bpos2, epos2; //
int diffs; //
int tlen; // tpoints[0..tlen) contains the inter trace point lengths in bseq
int *tpoints; // tdiffs[0..tlen) is the # of diffs in each tp interval
int *tdiffs;
} AlnRecord;
Load the alignment record at the reader's current cursor/position. The return pointer points at a pre-allocated buffer internal to the reader that is reused/overwritten each time alnAlignment is called. This includes the memory for the tpoints and tdiffs arrays of the trace. You should copy it and the two arrays just mentioned if you wish them to persist beyond the last call. If see_trace is true then the trace point arrays are sought and loaded so one can create cigar strings, etc. NULL is returned on error.
AlnRecord *alnAlignment(AlnReader *reader, bool see_trace)
Create a CIGAR string for the the given ALN record. This is only possible if see_seq was true when the alignment reader was opened, and see_trace was true when the alignment record was fetched. For this routine, the returned string must be freed by the user. NULL is returned on an error.
If show_x is true then 'X' and '=' are used to model stretches without indels, otherwise 'M' is used. When reversed is false, the CIGAR string is one that transforms the first sequence into the second where the first string is in the forward orientation. If reversed is true, then the CIGAR string is one that transforms the second sequence into the first where the second sequence is in the forward orientation, i.e. the roles of the first and second sequence are reversed.
char *alnCreateCigar(AlnRecord *align, bool show_x, bool reversed)
Create a CStag string for the the given ALN record. This is only possible if see_seq was true when the alignment reader was opened, and see_trace was true when the alignment record was fetched. For this routine, the returned string must be freed by the user. NULL is returned on an error.
If short_form is false then the normal CStag is created where the sequence of a matching segment is given, otherwise just the length of a matching segment is given. When reversed is false, the CS tag is one that transforms the first sequence into the second where the first string is in the forward orientation. If reversed is false, then the CS tag is one that transforms the second sequence into the first where the second sequence is in the forward orientation, i.e. the roles of the first and second sequence are reversed.
char *alnCreateCStag(AlnRecord *align, bool short_form, bool reversed)
Create an "indel array" for the the given ALN record. This is only possible if see_seq was true when the alignment reader was opened, and see_trace was true when the alignment record was fetched. For this routine, the returned integer is in a preallocated buffer of the reader, so you must make a copy if you wish it to persist beyond the next call to the package. NULL is returned on an error.
An indel array gives the locations at which a dash (-) should be inserted into either the first or second sequence in order to expose the alignment between the two sequences implied by the trace point intervals. A postive number x indicates one should place a dash before the x'th character of the first sequence, and a negative number -x indicates placing a dash before the x'th character of the second sequence. The absolute values of the dash locations is increasing along the array and the array is terminated by a 0 value.
The indices in the indel array are relative to the (sub)sequences that are aligned. This includes complementing the B/second sequence if necessary, so that the position 1 refers to the first character in the alignment for both sequences.
When reversed is false, the indel array is one that transforms the first sequence into the second where the first string is in the forward orientation. If reversed is true, then the indel array is one that transforms the second sequence into the first where the second sequence is in the forward orientation, i.e. the roles of the first and second sequence are reversed.
int *alnCreateIndelArray(AlnRecord *align, bool reversed)
Write a BLAST-like text display of an alignment to FILE where. For this routine to work it must be that see_seq was true when the alignment reader was opened, and see_trace was true when the alignment record was fetched. True is returned on error.
The display is indented by indent spaces, each displayed segment shows width columns of the alignment, border bp's before and after the aligned portion are also displayed, and the display width for coordinates is given by coord. Upper_case controls the case of the base pairs.
When reversed is false, the 1st sequence is displayed above the second with the first sequence in the forward direction. When reversed is true, the 2nd sequence is displayed above the first with the second sequence in the forward direction, i.e. the roles of the first and second sequence are reversed.
bool alnShowAlignment(AlnRecord *align, FILE *where,
int indent, int width, int border, int coord,
bool upper_case, bool reversed)
ERROR MESSAGES:
Find below a list of all error message followed by a list of the routines that can potentially encounter the error. Starred error message are controlled by CHECK_ARGS and so do not occur if this macro variable is set to undefined.
Could not open <path>/<root>.1aln
Out of memory (Opening .1aln file)
alnOpenReader
* Index out of range
* Could not seek to <idx>th alignment
alnGoto
* Scaffold index out of range
gdbScaffoldLen
gdbContigLen
gdbGapLen
gdbScaffoldContigs
gdbScaffoldStart
gdbScaffoldName
gdbScaffoldSeq
* Contig index out of range
gdbContigLen
gdbScaffoldStart
* Gap index out of range
gdbGapLen
* Sequence access not requested on open
Could not seek GDB sequence file
Could not read GDB sequence file
gdbScaffoldSeq
alnCreateCigar
alnCreateCStag
alnCreateIndelArray
alnShowAlignment
* Scaffold interval intersects a gap
Out of memory (Allocating sequence)
gdbScaffoldSeq
T-line not present in alignment record
T- and X-lines do not have the same length
D-line not present in alignment record
alnAlignment
Bad alignment between trace points
Trace point out of bounds
Alignment end points not in band
Self comparison can cross main diagonal
Out of memory (Enlarging trace vector)
Out of memory (Enlarging DP vector)
* Trace information was not requested when record fetched
alnCreateCigar
alnCreateCStag
alnCreateIndelArray
alnShowAlignment
Out of memory (Allocating CIGAR array)
Out of memory (Expanding CIGAR array)
alnCreateCigar
alnCreateCStag
Out of memory (Allocating CIGAR string)
alnCreateCigar
Out of memory (Allocating CS-tag string)
alnCreateCStag
In summary the following routines can return an error even if CHECK_ARGS is undefined, as they can encounter a read/seek failure, a memory allocation failure, or missing fields in a .1aln file
alnOpenReader
alnAlignment
gdbScaffoldSeq (iff buffer == NULL)
alnCreateCigar
alnCreateCStag
alnCreateIndelArray
alnShowAlignment