Barrnap
April 11, 2026 ยท View on GitHub
Barrnap
Annotate all the bacterial RNA in your genome
Description
Barrnap is an annotation tool for identifying RNA features in microbial genomes (bacteria, arhchea, fungi). It can find:
rRNA- ribosomal RNAtRNA- transfer RNAtmRNA- transfer messenger RNAncRNA- non-coding RNAmRNA- messenger RNA, inc.RBS,CDS,sig_pep,terminator
You provide a FASTA file, you get a GFF3 file. Too easy.
Installation
conda create -n barrnap -c bioconda -c conda-forge barrnap
conda activate barrnap
Quick start
# Backward compatible with the old versions - just rRNA
% barrnap test/small.fna
##gff-version 3
small infernal:1.1.5 rRNA 293312 294796 1.7e-49 + . Name=16S_rRNA;Alias=SSU_rRNA_bacteria;Dbxref=Rfam:RF00177;product=16S ribosomal RNA
small infernal:1.1.5 rRNA 295463 298336 4.8e-07 + . Name=23S_rRNA;Alias=LSU_rRNA_bacteria;Dbxref=Rfam:RF02541;product=23S ribosomal RNA
small infernal:1.1.5 rRNA 298432 298548 1.1e-13 + . Name=5S_rRNA;Alias=5S_rRNA;Dbxref=Rfam:RF00001;product=5S ribosomal RNA
# Use --all to find all the RNA
% barrnap --all --threads 8 test/small.fna
##gff-version 3
mall infernal:1.1.5 ncRNA 128 274 5.4e-05 + . Name=Cobalamin;Dbxref=Rfam:RF00174;product=Cobalamin riboswitch aptamer
small aragorn:1.2.41 tmRNA 15305 15616 . - . Name=tmRNA;product=transfer-messenger RNA (non-canonical) ANKIVSFSRQTAPVAA*
small aragorn:1.2.41 tRNA 86968 87039 . + . Name=tRNA-Asn;product=transfer RNA (gtt)
small barrnap:1.6.0 mRNA 188710 189808 . + . product=messenger RNA
small pyrodigal:3.7.0 RBS 188710 188715 119.0 + . product=ribosome binding site AGGAG
small pyrodigal:3.7.0 CDS 188726 189808 85.6 + 0 productr=hypothetical protein
small TransTermHP:2.09 terminator 189857 189880 100 + . product=Rho-independent terminator
small barrnap:1.6.0 operon 295463 298548 . + . Name=rRNA operon;product=rRNA operon: rRNA-rRNA
small infernal:1.1.5 rRNA 295463 298336 4.8e-07 + . Name=23S_rRNA;Alias=LSU_rRNA_bacteria;Dbxref=Rfam:RF02541;product=23S ribosomal RNA
small infernal:1.1.5 rRNA 298432 298548 1.1e-13 + . Name=5S_rRNA;Alias=5S_rRNA;Dbxref=Rfam:RF00001;product=5S ribosomal RNA
# You can make full GFFs with header and sequence
% barrnap --incseq --incseqreg test/fake.fna
##gff-version 3
##sequence-region contig001 1 733412
##sequence-region contig002 1 542170
##sequence-region contig003 1 31088
...
##FASTA
>contig001
CCGATTAGACCACTTTGCTGATAACAGTATTCATATCAATTGATTAGAAAGATTTCTTTT
TTGGTCACATTTTGATCACTTTTGAAGAAAACAATTTTTCTTCTAGGTTTTCCTTATGAG
AAGGAATTAGAATATTGACTAGATAGGTTCTAATGGGAATCAGCCATTGGAGGTAACGGG
...
Options
General
--helpshow help and exit--versionprint version in formbarrnap X.Yand exit--citationprint a citation and exit--debugwill write all tempfiles to '.' and print debug ingo
Database management
--listdbto see what DBs are installed--updatedbto update DBs from internet--dbdirto use a different DB folder
Search
--kingdomis the database to use: Bacteria:bac, Archaea:arc, Fungi:fun--allonly does rRNA scan, like versions < 1.0 did.--no-rrnadisables rRNA scan--trnaenables tRNA scan--ncrnaenabled ncRNA scan--mrnaenables mRNA scan (included CDS,RBS,sig_pep,terminator)
Speed
--threadsis how many CPUs to uase--fastuses simpler HMMs instead of CMs and it less accurate
Filtering
--evalueis the cut-off for hits to keep
Output
--quietwill not print any messages tostderr--incseqwill include the full input sequences in the output GFF--incseqregwill include##sequence-regionheaders in the GFF--outseqcreates a FASTA file with the hit sequences--adidswill add uniqueID=tags to each GFF3 feature
FAQ
What has changed since the 0.9 version?
- Barrnap now finds all RNA, not just
rRNA. Use the--legacyoption for backward compatiblity - I no longer use nucleotide HMMs and local alignment.
To get that behaviour use
--fast. - The
mitomodel is gone, thefunmodel is in. - The
--rejectand--lencutoffparamters are ignored now, as we use global CMs now. - SILVA is no longer used, all models are from Rfam.
- The
--rejectand--lencutoffparameters are no longer supported
Can I use Barrnap instead of Prokka ?
Yes. It's faster, and finds more features.
It's missing some things like EC_number
and COG annotations, and doen't produce
Genbank files.
Where does the name come from?
The name Barrnap was originally derived from Bacterial/Archaeal Ribosomal RNA Predictor. However it has since been extended to support mitochondrial and eukaryotic rRNAs, and has been given the new backronym BAsic Rapid Ribosomal RNA Predictor. The project was originally spawned at CodeFest 2013 in Berlin, Germany by Torsten Seemann and Tim Booth.
Databases
Barrnap sotres its database files in the db
folder, with a subfolder for each --kingdom.
% barrnap --listdb
[barrnap] Database home: /home/tseemann/git/barrnap/db
[barrnap] --kingdom 'arc' has: tRNA tmRNA ncRNA rRNA
[barrnap] --kingdom 'bac' has: tRNA tmRNA ncRNA rRNA
[barrnap] --kingdom 'fun' has: tRNA tmRNA ncRNA rRNA
Because the Rfam database does not update very often,
you rarely need to update them yourself using --updatedb.
When there are new models, I will update them
myself and make a new release of barrnap which
will likely have other bugfixes and features
you will want anyway.
References
Feedback
File questions, bugs, or ideas on the Issues page