Usage of qexperiment module
October 9, 2024 · View on GitHub
PCR simulation
Simulate PCR (Polymerase Chain Reaction) on a given DNA template using specific primers.
pcr(template, fw, rv, bindnum=16, mismatch=1, endlength=3, return_template=False, product=None, product=None, process_description=None, pn=None, pd=None)
Parameters
-
template:
QUEEN object
DNA template to be amplified. -
fw:
QUEEN objectorstr
Forward primer. Can be aQUEENobject or a string. -
rv:
QUEEN objectorstr
Reverse primer. Can be aQUEENobject or a string. -
bindnum:
int, optional
Minimum binding nucleotides for a primer. Default is 16. -
mismatch:
int, optional
Maximum mismatches allowed in primer binding. Default is 1. -
endlength:
int, optional
Length of primer's end region for binding consideration. Default is 3. -
add_primerbind
bool, optional
If True, add DNAfeature on the primer binding regions in the template DNA. -
tm_func
function, optional Function to calculate the melting temperature of the primer pair. Asstrspecfication, you can select"Breslauer"and"SantaLucia". Default is"SantaLucia".
Also, as built-in algorithms,QUEEN.qexperiment.Tm_NN(). This function is implemented based on theBio.SeqUtils.MeltingTemp.Tm_NN(), so the all parameters ofBio.SeqUtils.MeltingTemp.Tm_NN(), excludingseqandc_seq, can be acceptable. -
return_tm :
bool, optional If True, tm values of the primer pair are also returned.
The tm values will be calculated based on thier biding region excluding adaptor regions. -
product
str, optional
Product name. -
process_name or pn:
str, optional
Brief label for thepcrprocess. Default is"PCR". -
process_description or pd:
str, optional
Additional process description. -
pn
str, optional Alias forprocess_name. -
pd :
str, optional Alias forprocess_description.
Returns
QUEEN objectifreturn_tmis False, OtherwiseQUEEN object, (tm_fw, tm_rv)Returns the PCR product (amplicon) as a QUEEN object. Ifreturn_tmis True, the Tm values of the given primer pair is also returned.
Example Usage
>>> template = QUEEN("example_dna_sequence")
>>> forward_primer = "xxxxxxxxx"
>>> reverse_primer = "xxxxxxxxx"
>>> pcr_product = pcr(template, forward_primer, reverse_primer)
Digestion simulation
Simulate DNA digestion using restriction enzymes and optionally perform size selection.
digestion(dna, *cutsites, size_selection=None, requirement=None, product=None, process_name=None, process_description=None, pn=None, pd=None)
Parameters
-
dna:
QUEEN object
DNA sequence to be digested. -
cutsites:
Cutsiteorstr
Restriction enzymes for digestion. -
size_selection:
"min","max","label:*","!label:*", ortupleofint, optional Criteria for fragment selection. If"min"is provided, the minimum fragment of the digested fragments would be returned.
If"max"is provided, the maximum fragment of the digested fragments would be returned.
If"label:{feature_of_interest}"is provided, the unique fragment holding the DNAfeature withfeature_of_interestin "qualifer:label" would be returned. If multiple fragments holding the specified feature are detected, a error will be raised.
If"!label:{feature_of_interest}"is provided, the unique fragment not holding the DNAfeature withfeature_of_interestin "qualifer:label" would be returned. If multiple not fragments holding the specified feature are detected, a error will be raised. If atuplevalue is provided, The tuple (min_size,max_size) specifies the size range for filtering the resulting fragments. If multiple fragments holding the are detected in the specified range, a error will be raised.
IfNone, no filtering is done. Default isNone. -
product:
str, optional
Product name. -
process_name or pn:
str, optional
Brief label for thedigestionprocess. Default is "Digestion". -
process_description or pd (
str, optional)
Additional process description. -
pn
str, optional Alias forprocess_name. -
pd :
str, optional Alias forprocess_description.
Returns
listofQUEEN objectsorQUEEN objectIfselectionis None, return list of QUEEN objects composed of the digested fragments.
Otherwise, return a specific fragment filling the specified condition.
Example Usage
>>> dna_sequence = QUEEN("example_dna_sequence")
>>> fragments = digestion(dna_sequence, cs.lib["BamHI"], cutsite["AgeI"], size_selection=(100, 1000))
DNA Ligation Simulation
Simulate the ligation of DNA fragments into unique or multiple constructs.
ligation(*fragments, unique=True, follow_order=False, product=None, process_name=None, process_description=None, pn=None, pd=None):
Parameters
-
fragments:
listofQUEEN object
DNA fragments to be ligated. -
unique:
bool, optional
Whether to return only a unique construct. Default is True. -
follow_order :
bool, optional If True, a ligation reaction will be simulated along with the given order of fragments.
Default is False. -
product:
str, optional
Product name. -
process_name or pn:
str, optional
Brief label for the ligation process. Default is "Ligation". -
process_description or pd :
str, optional
Additional process description. -
pn
str, optional Alias forprocess_name. -
pd :
str, optional Alias forprocess_description.
Returns
- `QUEEN object` or
listofQUEEN objects
Construct(s) resulted from ligation.
Ifuniqueis True and only one construct is possible, returns that construct as a QUEEN object.
Ifuniqueis False, returns a list of all possible assembled constructs as QUEEN objects.
If no constructs are possible, returns an empty list or None.
Example Usage
>>> fragment1 = QUEEN("dna_fragment_1")
>>> fragment2 = QUEEN("dna_fragment_2")
>>> assembled_product = ligation(fragment1, fragment2, unique=True)
Notes
The function attempts all permutations and orientations of the given fragments for ligation.
If unique is set to True, it validates the uniqueness of the assembled product.
The function handles situations where the assembly is not possible or results in multiple products.
Homology-Based DNA Assembly Simulation
Simulate DNA assembly using homology for various assembly modes.
homology_based_assembly(*fragments, mode="gibson", homology_length=20, unique=True, follow_order=None, product=None, process_name=None, process_description=None, pn=None, pd=None)
Parameters
-
fragments:
QUEEN object
DNA fragments for assembly. -
mode:
str, optional
Assembly mode. Valid options are"gibson","infusion", anb"overlappcr". Default is"gibson". -
homology_length:
int, optional
Required homology length. Default is 20. -
unique:
bool, optional
Return only a unique construct. Default is True. -
follow_order :
bool, optional If True, a ligation reaction will be simulated along with the given order of fragments. If the number of given fragments is larger than 4, default is True. Otherwise, False. -
product:
str, optional
Product name. -
process_name or pn:
str, optional
Brief label for thehomology_based_assemblyprocess. Ifmodeis"gibson", default is"Gibson Assembly". Ifmodeis"infusion", default is"In-Fusion Assembly". -
process_description or pd:
str, optional
Additional description. -
pn
str, optional Alias forprocess_name. -
pd :
str, optional Alias forprocess_description.
Returns
QUEEN objector list ofQUEEN object
Construct(s) resulted from assembly.
Ifuniqueis True and only one construct is possible, returns that construct as a QUEEN object.
Ifuniqueis False, returns a list of all possible assembled constructs as QUEEN objects.
If no constructs are possible, returns an empty list or None.
Example Usage
>>> fragment1 = QUEEN("dna_fragment_1")
>>> fragment2 = QUEEN("dna_fragment_2")
>>> assembled_product = homology_based_assembly(fragment1, fragment2, mode="gibson", unique=True)
Notes
The function considers different assembly modes, each with its specific requirements for fragment or ientation and homology lengths. It handles permutations and orientations of the given fragments.
DNA Annealing Simulation
Simulate the annealing of two single-stranded DNA molecules based on homology.
annealing(ssdna1, ssdna2, homology_length=4, product=None, process_name=None, process_description=None, pn=None, pd=None)
Parameters
-
ssdna1 & ssdna2:
QUEEN object
Single-stranded DNAs for annealing. -
homology_length:
int, optional
Required homology length. Default is 4. -
product:
str, optional
Product name. -
process_name or pn:
str, optional
Brief label for theannealingprocess. Default is"Annealing". -
process_description or pd:
str, optional
Additional description. -
pn
str, optional Alias forprocess_name. -
pd :
str, optional Alias forprocess_description.
Returns
QUEEN object
Double-stranded DNA molecule after annealing.
Example Usage
>>> ssdna1 = QUEEN("ATCG")
>>> ssdna2 = QUEEN("CGAT")
>>> dsdna = annealing(ssdna1, ssdna2)
Gateway Reaction Simulation
Simulates a gateway reaction of two DNA molecules. For now, basic BP and LR reactions are available.
gateway_reaction(destination, entry, mode="BP", product=None, process_name=None, process_description=None, pn=None, pd=None)
Parameters
-
destination :
QUEEN objectThe destination QUEEN object holding the backbone DNA molecule. -
entry :
QUEEN objectThe entry QUEEN object holding the insert DNA molecule. -
mode:
str,tuple, orlist The mode of the reaction, can be "BP" or "LR". Default is "BP". For executing a custom BP or LR reaction, please speicy[B1 or L1 sequence, B1 or L2 sequence, P1 or R1 sequnce, P2 or R2 sequnece]` along with the QUEEN's cutsite format." -
process_name or pn:
str, optional
Brief label for theannealingprocess. Default is"Gateway Reaction". -
process_description or pd:
str, optional
Additional description. -
pn
str, optional Alias forprocess_name. -
pd :
str, optional Alias forprocess_description.
Returns
QUEEN objectThe QUEEN object representing the result of the gateway reaction process.
Golden Gate Assembly Simulation
Simulates a Golden Gate Assembly.
goldengate_assembly(destination, entry, cutsite=None, product=None, process_name=None, process_description=None, pn=None, pd=None, **kwargs)
Parameters
-
destination :
QUEEN objectThe destination QUEEN object holding the backbone DNA molecule. -
entry :
listofQUEEN objectsThe entry QUEEN object(s) holding the insert DNA molecules. -
cutsite :
CutsiteorstrThe restriction enzyme site used for this reaction. -
process_name : str, optional Brief label for the gateway reaction process. Default is "Golden Gate Assembly".
-
process_description : str, optional Additional description for the gateway reaction process.
-
pn : str, optional Alias for
process_name. -
pd : str, optional Alias for
process_description.
Returns
QUEEN objectThe QUEEN object representing the result of the Golden Gate Assembly.
Primer Design for PCR Amplification
Design forward and reverse primers for PCR amplification of a target region, allowing for the introduction of specific mutations, checking primer specificity, and meeting additional user-defined requirements. If a list of templates and targets is specified, a batch process will be executed for each template and target. In that case, the other parameters except for adapter_mode can also be specified as a list of appropriate class objects. However, each list should be the same length as the list of templates.
primerdesign(template, target, fw_primer=None, rv_primer=None, fw_margin=0, rv_margin=0, target_tm=60.0, tm_func=None, primer_length=(16, 25), design_num=1, fw_adapter=None, rv_adapter=None, adapter_mode="standard", homology_length=20, nonspecific_limit=3, auto_adjust=1, requirement=None, fw_name="fw_primer", rv_name="rv_primer")
Parameters
-
template:
QUEEN objectoflistofQUEEN objects. The QUEEN object to serve as the PCR template. If alistof templates is specified, appropriate primer pairs will be designed for each template. -
target:
QUEEN objectoflistofQUEEN objects. The sub-region in the template QUEEN object that needs to be included in the amplicon. If a list of targets is specified, the lengths should be the same, and each element should correspond to the template list. -
fw_primer:
ssDNA QUEEN objectorlistofssDNA QUEEN object, optional A specific forward primer sequence.
If provided, this sequence will be used as the forward primer. -
rv_primer:
ssDNA QUEEN objectorlistofssDNA QUEEN object, optional A specific reverse primer sequence.
If provided, this sequence will be used as the reverse primer. -
fw_margin & rv_margin:
intorlistof int, optional
Margins for primer design around the target region. -
target_tm:
floatorlistoffloat, optional
Desired primer Tm. Default is 60.0 °C. -
tm_func:
str, function orlistofstr/func, optional Function to calculate the melting temperature of the primer pair. Asstrspecfication, you can select"Breslauer" or "br"and"SantaLucia" or "sa". Default is"SantaLucia". Also, as built-in algorithms,QUEEN.qexperiment.Tm_NN(). This function is implemented based on theBio.SeqUtils.MeltingTemp.Tm_NN(), so the all parameters ofBio.SeqUtils.MeltingTemp.Tm_NN(), excludingseqandc_seq, can be acceptable. -
primer_length:
tupleofintpair orlistofintpairs, optional A tuple (min_size, max_size) specifying the primer length. Default is (16, 25). -
design_num:
intorlistofint, optional Number of primer pairs to design. Default is 1. -
adapter_mode:
"standard","gibson","infusion","overlappcr","RE", or"BP". Default is"standard".
The mode value specifies the the format offw_adapterandrv_adapter. In batch process mode, this value should be common for all processes -
fw_adapter
ssDNA QUEEN objectorstr, optional
If mode is"standard", the value must be a QUEEN object or astrobject representing a DNA sequence. The sequence will be added at the beginning of any forward primers designed.
If the mode is "gibson", "infusion", or "overlappcr", the value must be a dsDNA QUEEN object orNone. If the value isNoneand the target is specified as a list of QUEEN objects, the QUEEN object immediately preceding the target used for the current primer design will be automatically specified. The adapter sequence overlapping the specified QUEEN object will be automatically designed and prepended to the forward primer. If mode is"RE", the value must be a Cutsite object or astrobject representing a restriction enzyme (RE) site. The adapter sequence including the specified RE site will be added at the beginning of the forward primers. If mode is "BP", the value must be "attB1" or "attB2". The specified attB site will be added at the beginning of the forward primers. Currently, "attB1" and "attB2" are specified as follows:- attB1: GGGGACAAGTTTGTACAAAAAAGCAGGCT
- attB2: GGGGACCACTTTGTACAAGAAAGCTGGGT
-
rv_adapter:
ssDNA QUEEN objectorstr, optional
If mode is"standard", the value must be a QUEEN object or astrobject representing a DNA sequence. The sequence will be added at the beginning of any reverse primers designed.
If the mode is "gibson", "infusion", or "overlappcr", the value must be a dsDNA QUEEN object orNone. If the value isNoneand the target is specified as a list of QUEEN objects, the QUEEN object immediately following the target used for the current primer design will be automatically specified. The adapter sequence overlapping the specified QUEEN object will be automatically designed and prepended to the reverse primer. If mode is"RE", the value must be a Cutsite object or astrobject representing a restriction enzyme (RE) site. The adapter sequence including the specified RE site will be added at the beginning of the reverse primers.
If mode is "BP", the value must be "attB1" or "attB2". The specified attB site will be added at the beginning of the reverse primers. Currently, "attB1" and "attB2" are specified as follows:- attB1: GGGGACAAGTTTGTACAAAAAAGCAGGCT
- attB2: GGGGACCACTTTGTACAAGAAAGCTGGGT
-
homology_length:
intorlistofint, optional Required homology for adapters. -
nonspecific_limit:
intorlistofint, optional The maximum number of mismatches allowed for primer binding outside of the designated primer design region within the template sequence.
Primer pairs that bind to any region of the template with a number of mismatches equal to or less than this limit will be excluded from the design, to increase the specificity of the PCR reaction and decrease the likelihood of nonspecific amplification. Default is 3. -
requirement:
functionorlistoffunc, optional
Function that takes a dictionary representing a primer pair and returns True if the pair meets the specified conditions.
Ensures that the 3' end nucleotide of both primers is not A or T by default.
The detailed default function islambda x: x["fw"][-1] not in ("A", "T") and x["rv"][-1] not in ("A", "T")Default requirement is as follows.x["fw"][-1] not in ("A", "T") and x["rv"][-1] not in ("A", "T")"AAAA" not in x["fw"] and "TTTT" not in x["fw"] and "GGGG" not in x["fw"] and "CCCC" not in x["fw"]"AAAA" not in x["rv"] and "TTTT" not in x["rv"] and "GGGG" not in x["rv"] and "CCCC" not in x["rv"]
-
fw_name:
str, optional
Foward primer name, Default is "fw_primer". -
rv_name:
str, optional
Reverse primer name, Default is "rv_primer".
Returns
listofdictA list of dictionaries where each dictionary represents a primer pair.
Each dictionary contains two keys, "fw" and "rv", with the corresponding primer sequences formed by ssDNA QUEEN objects.
The list is sorted by the closeness of the primer's Tm to the target_tm, with the closest pair first.
Example Usage
>>> from QUEEN.queen import *
>>> template_Q = QUEEN('ATGC...')
>>> target_Q = QUEEN('ATGC...')
>>> #Assuming target_Q sequence is within template_Q
>>> primers = primerdesign(template_Q, target_Q, target_tm=65.0, num_design=5)
>>> primers
[
{"fw": QUEEN(seq="ATGCGT...", ssdna=True), "rv": QUEEN(seq="TACGCA...", ssdna=True)},
{"fw": QUEEN(seq="ATGCGT...", ssdna=True), "rv": QUEEN(seq="TACGCA...", ssdna=True)},
...
]
Notes
The requirement for the target sequence to be within the template sequence ensures specificity of the primers to the region of interest. The function will not proceed if the target sequence is not a subset of the template.
Under implementation
- intra_site_specific_recombination
- homologous_recombination