Run automated evaluation

November 2, 2025 · View on GitHub

Documentation Status PyPI PyPI Downloads Python Versions (omnigenbench) License

📦 Installation · 🚀 Getting Started · 🧬 Model Support · 📊 Benchmarks · 🧪 Application Tutorials · 📚 Paper

🔍 What You Can Do with OmniGenBench?

  • 🧬 Benchmark effortlessly — Run automated and reproducible evaluations for genomic foundation models
  • 🧠 Understand your models — Explore interpretability across diverse tasks and species
  • ⚙️ Run tutorials instantly — Use click-to-run guides for genomic sequence modeling
  • 🚀 Fine-tune and infer efficiently — Accelerated workflows for fine-tuning and inference on GFMs on downstream tasks

Installation

Requirements

Before installing OmniGenBench, ensure you have the following:

  • Python: 3.10 or higher (3.12 recommended for best compatibility)
  • PyTorch: 2.6.0 or higher (with CUDA support for GPU acceleration)
  • Transformers: 4.46.0 or higher (HuggingFace library)

Install the latest stable release from PyPI:

# Create dedicated conda environment (recommended)
conda create -n omnigen_env python=3.12
conda activate omnigen_env

# Install OmniGenBench
pip install omnigenbench -U

Source Installation (For Development)

Clone the repository and install in editable mode for development:

git clone https://github.com/yangheng95/OmniGenBench.git
cd OmniGenBench
pip install -e .

Note: For RNA structure prediction and design features, ViennaRNA is required. Install via conda: conda install -c bioconda viennarna

Quick Start

OmniGenBench provides unified interfaces for model inference, automated benchmarking, and fine-tuning across 30+ genomic foundation models and 80+ standardized tasks.

Auto-inference via CLI

Run inference with fine-tuned models on genomic sequences:

# Single sequence inference (TF binding prediction)
ogb autoinfer \
    --model yangheng/ogb_tfb_finetuned \
    --sequence "ATCGATCGATCGATCG" \
    --output-file predictions.json

# Batch inference from file (translation efficiency prediction)
ogb autoinfer \
    --model yangheng/ogb_te_finetuned \
    --input-file sequences.json \
    --batch-size 64 \
    --output-file results.json

Auto-inference via Python API

Programmatic inference with three-line workflow:

from omnigenbench import ModelHub

# Load fine-tuned model from HuggingFace Hub
model = ModelHub.load("yangheng/ogb_tfb_finetuned")

# Predict transcription factor binding (919 TFs, multi-label classification)
outputs = model.inference("ATCGATCGATCGATCGATCGATCGATCGATCG" * 10)
print(outputs)
# {'predictions': array([1, 0, 1, ...]), 
#  'probabilities': array([0.92, 0.15, 0.87, ...])}

# Interpret results
import numpy as np
binding_sites = np.where(outputs['predictions'] == 1)[0]
print(f"Predicted binding: {len(binding_sites)}/919 transcription factors")

More Examples: See Getting Started Guide and AutoInfer Examples for advanced usage patterns.

Auto-benchmark via CLI

Automated benchmarking with statistical rigor (multi-seed evaluation):

# Evaluate model on RGB benchmark (12 RNA tasks) with 3 random seeds
ogb autobench \
    --model yangheng/OmniGenome-186M \
    --benchmark RGB \
    --seeds 0 1 2 \
    --trainer accelerate

# Legacy command (still supported for backward compatibility)
# autobench --config_or_model "yangheng/OmniGenome-186M" --benchmark "RGB"

Output: Results include mean ± standard deviation for each metric (e.g., MCC: 0.742 ± 0.015, F1: 0.863 ± 0.009)

Visualization: See AutoBench GIF for workflow demonstration.

Auto-benchmark via Python API

Programmatic benchmarking with flexible configuration:

from omnigenbench import AutoBench

# Initialize benchmark
gfm = 'LongSafari/hyenadna-medium-160k-seqlen-hf'
benchmark = "RGB"  # Options: RGB, BEACON, PGB, GUE, GB
bench_size = 8
seeds = [0, 1, 2, 3, 4]  # Multi-seed for statistical rigor

# Run automated evaluation
bench = AutoBench(
    benchmark=benchmark,
    config_or_model=gfm,
    overwrite=False  # Skip completed tasks
)
bench.run(autocast=False, batch_size=bench_size, seeds=seeds)

Advanced Usage: See Benchmarking with LoRA for parameter-efficient fine-tuning during evaluation.

Supported Models

OmniGenBench provides plug-and-play evaluation for 30+ genomic foundation models, covering both RNA and DNA modalities across multiple species. All models integrate seamlessly with the framework's automated benchmarking and fine-tuning workflows.

Representative Models

ModelParamsPre-training CorpusKey Features
OmniGenome186M54B plant RNA+DNA tokensMulti-modal encoder, structure-aware, plant-specialized
Agro-NT-1B985M48 edible-plant genomesBillion-scale DNA LM with NT-V2 k-mer vocabulary
RiNALMo651M36M ncRNA sequencesLargest public RNA LM with FlashAttention-2
DNABERT-2117M32B DNA tokens, 136 species (BPE)Second-generation DNA BERT with byte-pair encoding
RNA-FM96M23M ncRNA sequencesHigh performance on RNA structure prediction tasks
RNA-MSM96MMulti-sequence alignmentsMSA-based evolutionary modeling for RNA
NT-V296M300B DNA tokens (850 species)Hybrid k-mer vocabulary, cross-species
HyenaDNA47MHuman reference genomeLong-context (160k-1M tokens) autoregressive model
SpliceBERT19M2M pre-mRNA sequencesFine-grained splice-site recognition
Caduceus1.9MHuman chromosomesUltra-compact reverse-complement equivariant DNA LM
RNA-BERT0.5M4,000+ ncRNA families (Rfam)Compact RNA BERT with nucleotide-level masking

Complete Model List: See Appendix E of the paper for all 30+ supported models, including PlantRNA-FM, UTR-LM, MP-RNA, CALM, and more.

Model Access: All models are available on HuggingFace Hub and can be loaded with ModelHub.load("model-name").

Benchmarks

OmniGenBench supports five curated benchmark suites covering both sequence-level and structure-level genomics tasks across species. All benchmarks are automatically downloaded from HuggingFace Hub on first use.

SuiteFocus#Tasks / DatasetsRepresentative Tasks
RGBRNA structure + function12 tasks (SN-level)Secondary structure, solvent accessibility, degradation
BEACONRNA (multi-domain)13 tasksBase pairing, mRNA design, RNA contact prediction
PGBPlant long-range DNA7 categoriesPolyA signal, enhancer, chromatin, splice site (up to 50kb context)
GUEDNA general understanding36 datasets (9 tasks)TF binding, core promoter, enhancer, epigenetics
GBClassic DNA classification9 datasetsHuman/mouse enhancers, promoter variant classification

Evaluation Protocol: All benchmarks follow standardized protocols with multi-seed evaluation (typically 3-5 runs) for statistical rigor. Results report mean ± standard deviation for each metric.

Accessing Benchmarks: Use AutoBench(benchmark="RGB") or ogb autobench --benchmark RGB to automatically download and evaluate on any suite.

Tutorials

RNA Design

RNA design is the inverse problem of RNA structure prediction: given a target secondary structure (in dot-bracket notation), design RNA sequences that fold into that structure. OmniGenBench provides both CLI and Python API for RNA sequence design using genetic algorithms enhanced with masked language modeling.

CLI Usage

# Basic RNA design for a simple hairpin structure
ogb rna_design --structure "(((...)))"

# Design with custom parameters for better results
ogb rna_design \
    --structure "(((...)))" \
    --model yangheng/OmniGenome-186M \
    --mutation-ratio 0.3 \
    --num-population 200 \
    --num-generation 150 \
    --output-file results.json

# Design complex structure (stem-loop-stem)
ogb rna_design \
    --structure "(((..(((...)))..)))" \
    --num-population 300 \
    --num-generation 200 \
    --output-file complex_design.json

Note: RNA design is now available through the unified ogb command interface.

Python API Usage

from omnigenbench import OmniModelForRNADesign

# Initialize model
model = OmniModelForRNADesign(model="yangheng/OmniGenome-186M")

# Design sequences for target structure
sequences = model.design(
    structure="(((...)))",      # Target structure in dot-bracket notation
    mutation_ratio=0.5,          # Mutation rate for genetic algorithm
    num_population=100,          # Population size
    num_generation=100           # Number of generations
)

print(f"Designed {len(sequences)} sequences:")
for seq in sequences[:5]:
    print(f"  {seq}")

Key Features:

  • 🧬 Multi-objective genetic algorithm with MLM-guided mutations
  • ⚡ Automatic GPU acceleration for large populations
  • 📊 Real-time progress tracking with early termination
  • 🎯 Returns multiple optimal solutions (up to 25 sequences)
  • 💾 JSON output format for downstream analysis

Common Structure Patterns:

  • Simple hairpin: "(((...)))"
  • Stem-loop-stem: "(((..(((...)))..)))"
  • Multi-loop: "(((...(((...)))..(((...))).)))"
  • Long stem: "((((((((....))))))))"

The comprehensive tutorials of RNA Design can be found in:

You can find a visual demo of RNA Design here.

RNA Secondary Structure Prediction

RNA secondary structure prediction is a fundamental problem in computational biology, where the goal is to predict the secondary structure of an RNA sequence. In this demo, we show how to use OmniGenBench to predict the secondary structure of RNA sequences using a pre-trained model. The tutorials of RNA Secondary Structure Prediction can be found in Secondary_Structure_Prediction_Tutorial.ipynb(examples/rna_secondary_structure_prediction/00.ipynb).

You can find a visual example of RNA Secondary Structure Prediction here.

More Tutorials

Please find more usage tutorials in examples.

Citation

@article{yang2024omnigenbench,
      title={OmniGenBench: A Modular Platform for Reproducible Genomic Foundation Models Benchmarking}, 
      author={Heng Yang and Jack Cole, Yuan Li, Renzhi Chen, Geyong Min and Ke Li},
      year={2024},
      eprint={https://arxiv.org/abs/2505.14402},
      archivePrefix={arXiv},
      primaryClass={q-bio.GN},
      url={https://arxiv.org/abs/2505.14402}, 
}

License

OmniGenBench is licensed under the Apache License 2.0. See the LICENSE file for more information.

Contribution

We welcome contributions to OmniGenBench! If you have any ideas, suggestions, or bug reports, please open an issue or submit a pull request on GitHub.