Updates:

• 09.2023 - added data from MirGeneDB 2.1, duplicate records removed

In this document you can find short instructions for using databases of small non-coding RNAs published in article ITAS: integrated transcript annotation for small RNA (https://doi.org/10.3390/ncrna8030030).

Integrated annotation was created for precursors and mature miRNA, piRNA, rRNA, tRNA and tRNA fragments for human, mouse, rat, C.elegans and D.melanogaster.

Archived databases gtf-files can be found in the directory https://github.com/EpiEpiMSU/ITAS/tree/main/Integrated_annotation

Scripts, which were used to obtain this databases located in the directory https://github.com/EpiEpiMSU/ITAS_scripts

Structure of gtf-files

One small noncoding RNA often has many loci across the genome. Because of that we have used “exon” in the feature field, the same transcript_id, but different transcript_copy_id for genomic loci of the certain transcript.

For example:

chr2 pirnadb_v1_7_6 exon 10486586 10486608 . + . transcript_id "mmu-piR-10017"; transcript_copy_id "mmu-piR-10017_1"; sequence "AGTTGTGTGTGCATGTTCATGT"

chr2 pirnadb_v1_7_6 exon 10481682 10481704 . + . transcript_id "mmu-piR-10017"; transcript_copy_id "mmu-piR-10017_2"; sequence "AGTTGTGTGTGCATGTTCATGT"

chr2 pirnadb_v1_7_6 exon 10484140 10484162 . + . transcript_id "mmu-piR-10017"; transcript_copy_id "mmu-piR-10017_3"; sequence "AGTTGTGTGTGCATGTTCATGT"

Download and uncompress the database

#downloading whole database

git clone https://github.com/EpiEpiMSU/ITAS

#for unziping files we recommend you to use 7z tool (commands unzip/gzip don`t work directly with multi-part archives)

sudo apt install p7zip-full

#extracting whole database

7z x -y -r ITAS -o./whole_database

#extracting specific database (mouse, for example)

7z x -y -r ITAS/Integrated_annotation/mouse/ -o ./mouse_snRNA_databases

---