Shovill
December 13, 2025 ยท View on GitHub
Shovill
Assemble bacterial isolate genomes from Illumina paired-end reads
Introduction
The SPAdes genome assembler has become the de facto standard de novo genome assembler for Illumina whole genome sequencing data of bacteria and other small microbes. SPAdes was a major improvement over previous assemblers like Velvet, but some of its components can be slow and it traditionally did not handle overlapping paired-end reads well.
Shovill is a pipeline which uses SPAdes at its core, but alters the steps before and after the primary assembly step to get similar results in less time. Shovill also supports other assemblers like SKESA, Velvet and Megahit, so you can take advantage of the pre- and post-processing the Shovill provides with those too.
:warning: Shovill is for isolate data only, primarily small haploid organisms. It will NOT work on metagenomes or larger genomes. Please use Megahit directly instead.
Main steps
- Estimate genome size and read length from reads (unless
--gsizeprovided) - Reduce FASTQ files to a sensible depth (default
--depth 150) - Trim adapters from reads (with
--trimonly) - Conservatively correct sequencing errors in reads
- Pre-overlap ("stitch") paired-end reads
- Assemble with SPAdes/SKESA/Megahit with modified kmer range and PE + long SE reads
- Correct minor assembly errors by mapping reads back to contigs
- Remove contigs that are too short, too low coverage, or pure homopolymers
- Produce final FASTA with nicer names and parseable annotations
Quick Start
% shovill --outdir out --R1 test/R1.fq.gz --R2 test/R2.fq.gz
<snip>
Final assembly in: test/contigs.fa
It contains 17 (min=150) contigs totalling 169611 bp.
Done.
% ls out
contigs.fa contigs.gfa shovill.corrections
shovill.log spades.fasta
% head -n 4 out/contigs.fa
>contig00001 len=52653 cov=32.7 corr=1 origname=NODE_3 date=20180327 sw=shovill/1.0.1
ATAACGCCCTGCTGGCCCAGGTCATTTTATCCAATCTGGACCTCTCGGCTCGCTTTGAAGAAT
GAGCGAATTCGCCGTTCAGTCCGCTGGACTTCGGACTTAAAGCCGCCTAAAACTGCACGAACC
ATTGTTCTGAGGGCCTCACTGGATTTTAACATCCTGCTAACGTCAGTTTCCAACGTCCTGTCG
Installation
Conda
conda install bioconda::shovill
shovill --version
shovill --check
Using Bioconda will install all the dependencies for you on MacOS and Linux.
Containers
The Docker recipe is generously maintained by Curtis Kapsak and the StaPH-B workgroup.
# Docker
docker pull staphb/shovill:latest
docker run staphb/shovill:latest shovill --help
# Singularity
singularity build shovill.sif docker://staphb/shovill:latest
singularity exec shovill.sif shovill --help
Source
git clone https://github.com/tseemann/shovill.git
conda env create -n shovill -f shovill/environment.yml
conda activate shovill
./shovill/bin/shovill --help
./shovill/bin/shovill --check
You will need to install all the dependencies manually:
- SPAdes >= 3.11, < 4.0.0
- SKESA
- MEGAHIT
- Velvet >= 1.2
- Lighter
- FLASh
- SAMtools >= 1.3 (prefer >= 1.10)
- BWA MEM
- KMC
- seqkit
- csvtk
- pigz. Pigz should be available with your OS distribution.
- Pilon (Java).
- Trimmomatic (Java)
- samclip
Note that you will need to make pilon and trimmomatic executables. You can make a simple wrapper for each that just passes the shell arguments.
Output files
These are based on using --assembler ASSEMBLER:
| Filename | Description |
|---|---|
contigs.fa | The final assembly you should use |
shovill.log | Full log file for bug reporting |
shovill.corrections | List of post-assembly corrections |
ASSEMBLER.fasta | Raw assembly from ASSEMBLER |
ASSEMBLER.{gfa,fastg,LastGraph} | Raw assembly graph from ASSEMBLER |
contigs.fa
This is most important output file - the final, corrected assembly. It contains entries like this:
>contig00001 len=263154 cov=8.9 corr=1 origname=NODE_1 date=20180327 sw=shovill/0.9
>contig00041 len=339 cov=8.8 corr=0 origname=NODE_41 date=20180327 sw=shovill/0.9
The sequence IDs are named as per the --namefmt option, and the comment field
is a series of space-separated name=value pairs with the following meanings:
| Pair | Meaning |
|---|---|
len | Length of contig in basepairs |
cov | Average k-mer coverage as reported by assembler |
corr | Number of post-assembly corrections (unless --nocorr used) |
origname | The original name of the contig (before applying --namefmt) |
date | YYYYMMDD date when this contig was assembled |
sw | shovill-engine/version where engine is the --assembler chosen |
Advanced options
SYNOPSIS
De novo assembly pipeline for Illumina paired reads
USAGE
shovill [options] --outdir DIR --R1 R1.fq.gz --R2 R2.fq.gz
GENERAL
--help This help
--version Print version and exit
--check Check dependencies are installed
INPUT
--R1 XXX Read 1 FASTQ (default: '')
--R2 XXX Read 2 FASTQ (default: '')
--depth N Sub-sample --R1/--R2 to this depth. Disable with --depth 0 (default: 150)
--gsize XXX Estimated genome size eg. 3.2M <blank=AUTODETECT> (default: '')
OUTPUT
--outdir XXX Output folder (default: '')
--force Force overwite of existing output folder (default: OFF)
--minlen N Minimum contig length <0=AUTO> (default: 0)
--mincov n.nn Minimum contig coverage <0=AUTO> (default: 2)
--namefmt XXX Format of contig FASTA IDs in 'printf' style (default: 'contig%05d')
--keepfiles Keep intermediate files (default: OFF)
RESOURCES
--tmpdir XXX Fast temporary directory (default: '/tmp/tseemann')
--cpus N Number of CPUs to use (0=ALL) (default: 8)
--ram n.nn Try to keep RAM usage below this many GB (default: 16)
ASSEMBLER
--assembler XXX Assembler: skesa velvet megahit spades (default: 'spades')
--plasmid Enable plasmid mode where possible
--opts XXX Extra assembler options in quotes eg. spades: "--untrusted-contigs locus.fna" ... (default: '')
--kmers XXX K-mers to use <blank=AUTO> (default: '')
MODULES
--trim Enable adaptor trimming (default: OFF)
--noreadcorr Disable read error correction (default: OFF)
--nostitch Disable read stitching (default: OFF)
--nocorr Disable post-assembly correction (default: OFF)
--depth
Giving an assembler too much data is a bad thing. There comes a point where you are no longer adding new information (as the genome is a fixed size), and only adding more noise (sequencing errors). Most assemblers seem to be happy with ~150x depth, so Shovill will downsample your FASTQ files to this depth. It estimates depth by dividing read yield by genome size.
--gsize
The genome size is needed to estimate depth and for the read error correction stage.
If you don't provide --gsize, it will be estimated via k-mer frequencies using mash.
It doesn't need to be a perfect estimate, just in the right ballpark.
--plasmid
If the assembler supports a speical mode for
assemlbiing plasmids, it will be enabled.
Currently only --assembler spades supports this.
--keepfiles
This will keep all the intermediate files in --outdir so you can explore and debug.
--cpus
By default it will attempt to use all available CPU cores.
--ram
Shovill will do its best to keep memory usage below this value, but it is not guaranteed. If you are on a HPC cluster, you should make sure you tell your job submission engine a value higher than this.
--assembler
By default it will use SPAdes, but you can also choose Megahit or SKESA. These are much
faster than SPAdes, but give lesser assemblies. If you use SKESA you can probably use
--noreadcorr and --nocoor because it has some of that functionality inbuilt and is
conservative.
--opts
If you want to provide some assembler-specific parameters you can use the --opts
parameter. Make sure you quote the parameters so they get passed as a single string
eg. For --assembler spades you might use
--opts "--sc --untrusted-contigs similar_genome.fasta" or --opts '--sc'.
--kmers
A series of kmers are chosen based on the read length distribution. You can override this with this option.
Choosing which stages to use
| Stage | Enable | Disable |
|---|---|---|
| Genome size estimation | default | --gsize XX |
| Read subsampling | --depth N | --depth 0 |
| Read trimming | --trim | default |
| Read error correction | default | --noreadcorr |
| Read stitching/overlap | default | --nostitch |
| Contig correction | default | --nocorr |
Environment variables recognised
These env-vars will be used as defaults instead of the built-in defaults. You can use the normal command line option to override them still.
| Variable | Option | Default |
|---|---|---|
$SHOVILL_CPUS | --cpus | 8 |
$SHOVILL_RAM | --ram | 16 |
$SHOVILL_ASSEMBLER | --assembler | spades |
$TMPDIR | --tmpdir | /tmp |
Running multiple assemblies
Although shovill does not have native support
to run lots of assemblies, it can be achieved
quite elegantly with stanfdard Unix toiols:
Firstly, create an input file in TSV format:
% cat input.tsv
StrainA A_R1.fq.gz A_R1.fq.gz
StrainB B_R1.fq.gz B_R1.fq.gz
StrainC C_R1.fq.gz B_R1.fq.gz
Then use the GNU parallel command:
% parallel -a input.tsv -j 1 --col-sep "\t" "shovill --outdir {1} --R1 {2} --R2 {3}"
This will read input.tsv one line at a time,
and put the columns into valiables {1} {2} {3|
and pass them to a shovill command.
You can customize this to change any
parameters or output options as needed.
FAQ
-
Does
shovillwotk with Spades 4.x ?SOme people are reporting issues, so I am removing support for 4.x until this is fixed
-
Does
shovillaccept single-end reads?No, but it might one day.
-
Do you support long reads from Pacbio or Nanopore?
No, this is strictly for Illumina paired-end reads only. Try use Flye. CANU, or Redbean.
-
Why does Shovill crash?
Shovill has a lot of dependencies. If any dependencies are not installed correctly it will die. Spades[5~ also doesn't handle --cpus > 16 very well - try giving more RAM.
-
Can I assemble metagenomes with Shovill?
No. Please use dedicated tools like Minia 3.x or Megahit. Shovill uses the estimated genome size for many dynamic settings related to read error correction, read subsampling etc.
Feedback
Please file questions, bugs or ideas to the Issue Tracker
License
Citation
Seemann T (2016) Shovill Github https://github.com/tseemann/shovill
Author
- Torsten Seemann
- Web: https://tseemann.github.io/
- Twitter: @torstenseemann
- Blog: The Genome Factory
Contributors
- Jason Kwong
- Simon Gladman
- Anders Goncalves da Silva